From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0387 [new locus tag: NWMN_RS02185 ]
  • pan locus tag?: SAUPAN002102000
  • symbol: NWMN_0387
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0387 [new locus tag: NWMN_RS02185 ]
  • symbol: NWMN_0387
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 434715..435560
  • length: 846
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAATATTATGTTAACAGGTGCTACAGGTCATTTAGGCACACATATTACAAATCAAGCC
    ATTGCAAATCACATAGATCATTTTCACATTGGTGTTAGAAATGTTGAGAAAGTTCCAGAA
    GATTGGCGCGGAAAAGTTCCTGTTCGACAATTAGATTATTTTAATCAAGAAAGCATGGTA
    GAAGCATTTAAAGGAATGGATACCGTTGTGTTTATTCCAAGTATTATCCATCCATCATTC
    AAACGTATTCCTGAAGTGGAAAATTTAGTATATGCGGCAAAGCAGAGCGGCGTTGCTCAT
    ATCATTTTCATAGGTTATTACGCAGATCAGCATAATAATCCATTCCATATGAGTCCTTAT
    TTTGGTTATGCAGCACGTCTATTGGCAACAAGTGGCATTGACTATACGTATGTAAGAATG
    GCAATGTACATGGATCCACTTAAACCATATTTACCAGAATTGATGAATATGCATAAACTG
    ATTTATCCAGCTGGCGATGGTCGTATTAATTATATTACTAGAAATGATATTGCTAGAGGT
    GTCATTGCTATTATTAAAAATCCAGATACTTGGGGCAAACGCTACTTATTATCAGGCTAC
    AGTTATGATATGAAAGAACTTGCTGCAATTTTATCTGAGGCATCAGGCACAGAAATTAAA
    TATGAGCCCGTTTCATTAGAGACATTTGCAGAAATGTATGATGAACCTAAAGGCTTTGGT
    GCATTATTGGCATCAATGTACGACGCAGGAGCAAGAGGACTATTAGACCAAGAATCCAAT
    GATTTCCAACAATTAGTCAATGATCAACCACAGACACTGCAATCATTTTTACAAGAAAAT
    ATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    846

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0387 [new locus tag: NWMN_RS02185 ]
  • symbol: NWMN_0387
  • description: hypothetical protein
  • length: 281
  • theoretical pI: 5.7659
  • theoretical MW: 31827.1
  • GRAVY: -0.219929

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    ergot alkaloid biosynthesis protein, AFUA_2G17970 family (TIGR03649; HMM-score: 49.7)
    Hypothetical proteinsConservedTIGR01777 family protein (TIGR01777; HMM-score: 17.2)
    hopanoid-associated sugar epimerase (TIGR03466; HMM-score: 16.8)
    thioester reductase domain (TIGR01746; HMM-score: 14.5)
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 12.7)
  • TheSEED:  
    FIG01108224: hypothetical protein 
  • PFAM:
    NADP_Rossmann (CL0063) NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 80.3)
    NmrA; NmrA-like family (PF05368; HMM-score: 71.1)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 22.8)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 12.7)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.23
    • Ymax_pos: 23
    • Cmax: 0.234
    • Cmax_pos: 23
    • Smax: 0.428
    • Smax_pos: 19
    • Smean: 0.214
    • D: 0.223
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNIMLTGATGHLGTHITNQAIANHIDHFHIGVRNVEKVPEDWRGKVPVRQLDYFNQESMVEAFKGMDTVVFIPSIIHPSFKRIPEVENLVYAAKQSGVAHIIFIGYYADQHNNPFHMSPYFGYAARLLATSGIDYTYVRMAMYMDPLKPYLPELMNMHKLIYPAGDGRINYITRNDIARGVIAIIKNPDTWGKRYLLSGYSYDMKELAAILSEASGTEIKYEPVSLETFAEMYDEPKGFGALLASMYDAGARGLLDQESNDFQQLVNDQPQTLQSFLQENI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]