From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0572 [new locus tag: NWMN_RS03275 ]
  • pan locus tag?: SAUPAN002463000
  • symbol: NWMN_0572
  • pan gene symbol?: iolS
  • synonym:
  • product: aldo/keto reductase family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0572 [new locus tag: NWMN_RS03275 ]
  • symbol: NWMN_0572
  • product: aldo/keto reductase family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 653120..654058
  • length: 939
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAAGCAATTTGTAAACTTAGGTAAATCTGATGTTGAAGTGTTTCCAATCGCACTTGGG
    ACGAACGCAGTAGGTGGGCATAATTTATATCCGAACTTAGATGAAGAACAAGGAAAAGAT
    GTTGTTCGTCAAGCCATTAATCATGGTATTAATTTATTAGATACGGCATATATTTATGGG
    CCAGAACGATCAGAAGAATTGGTTGGAGAAGTTGTTAAAGAATATCCGCGAGAGCAAATT
    AAAATTGCTACGAAAGGGTCTCATGAATTTGATGAAAATCAAGAAGTACATCAGAACAAT
    CAACCGGAATATTTAAAACAACAAGTTGAGAATAGTTTGAAACGTCTACAAACTGATTAT
    ATCGATTTATATTATATTCATTTTCCGGATAACAACACTCCGAAAGATCAAGCAGTTGCA
    GCATTACAAGAGCTTAAGGAACAAGGGAAGATTAAAGCAATTGGTGTATCAAATTTCACA
    TTAGATCAACTTAAAGAAGCAAATAAAGATGGTTACGTTGATGTTGTACAGTTAGAATAT
    AATTTATTGCATCGCGAAAATGAGGCAGTATTACAATATTGTGTTGATCACCAAATCACA
    TTTATTCCATATTTCCCATTAGCATCCGGTATTTTAGCTGGAAAATATGATGAGAACACT
    AAATTTAGTGACCATCGTACTACACGTCGTGATTTTAAACCAGGTGTATTTGAAGAAAAT
    GTGCGTCGCGTAAAAGCTTTGGAAAGCATAGCTGCAGCACATCAAACTTCAATTGCGAAC
    ATTGTATTAGCATTTTATTTAACGAGACCAGCTATCGATGTGATTATTCCTGGTGCAAAA
    CGTGCAGAACAAGTCGTTGAAAATATTAAAGCTGCAGATATCGTTTTATCAGATGATGAG
    ATTCAATATATCGATGAACTGTTTCCGATTGAAGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    939

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0572 [new locus tag: NWMN_RS03275 ]
  • symbol: NWMN_0572
  • description: aldo/keto reductase family protein
  • length: 312
  • theoretical pI: 4.6314
  • theoretical MW: 35459.5
  • GRAVY: -0.465385

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    voltage-dependent potassium channel beta subunit (TIGR01293; HMM-score: 90.4)
  • TheSEED:  
    Oxidoreductase ion channel 
  • PFAM:
    no clan definedAldo_ket_red; Aldo/keto reductase family (PF00248; HMM-score: 255.8)
    NADP_Rossmann (CL0063) Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 16.3)
    HAD (CL0137) Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 13.7)
    no clan definedRasGAP_C; RasGAP C-terminus (PF03836; HMM-score: 13)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_1178(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_1547(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    NWMN_1573(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0357(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    NWMN_0359(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    NWMN_1456(sodA)superoxide dismutase Mn/Fe family protein  [1] (data from MRSA252)
    NWMN_0055(spa)immunoglobulin G binding protein A precursor (protein A)  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.152
    • Ymax_pos: 27
    • Cmax: 0.11
    • Cmax_pos: 27
    • Smax: 0.263
    • Smax_pos: 22
    • Smean: 0.194
    • D: 0.169
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKQFVNLGKSDVEVFPIALGTNAVGGHNLYPNLDEEQGKDVVRQAINHGINLLDTAYIYGPERSEELVGEVVKEYPREQIKIATKGSHEFDENQEVHQNNQPEYLKQQVENSLKRLQTDYIDLYYIHFPDNNTPKDQAVAALQELKEQGKIKAIGVSNFTLDQLKEANKDGYVDVVQLEYNLLHRENEAVLQYCVDHQITFIPYFPLASGILAGKYDENTKFSDHRTTRRDFKPGVFEENVRRVKALESIAAAHQTSIANIVLAFYLTRPAIDVIIPGAKRAEQVVENIKAADIVLSDDEIQYIDELFPIED

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24

Relevant publications[edit source | edit]