From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0651 [new locus tag: NWMN_RS03695 ]
  • pan locus tag?: SAUPAN002566000
  • symbol: NWMN_0651
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0651 [new locus tag: NWMN_RS03695 ]
  • symbol: NWMN_0651
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 731380..732063
  • length: 684
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGATAAGAAAAAAGTCATCAAATTTATGATTAATGTATTACCAATTGTATTGGTACCG
    TTAATTGTTGAACGTAAACGTATCAAACAACATCCGGACGTACAAAAAGTTACAGATGCT
    ACAAGTAAAGTTGCTTCAAAAACATCTGCAGCAATCAGTAACACAGCGAGTGATGTTAAA
    GAATATGTCGGCGATAAAAAACAAGATTTTGAAAATAAACGTGAACTTAAAAAGTTTGCT
    AGAGAACATGATCCTGCCTATATTGAGAAAAAAGGCGAAAAATTAGCTAAACAAAATCGT
    AAAGACGCTGATAAAATGAATAAAATACTTCAAAAAAATATCGAAAAGCGTCATAAAGAA
    GAGCAAAAAGCCCGCGAAAAGAATGAAATACAACGTATTAAAGATATGAAAAAATCACAA
    AAATACGAAGAAAAAGCAGGCTTAACACCTAATAAATTAGATGAGAAAACTGAGAAAAAA
    GGCGATAAACTAGCTGAAAAAAATCGCAAAGAAATCGCTAAAATGAATAAAAAGTTACAA
    AAAAATATTGAAAAACGACACAAAGAAGAACAAAAACGCCAACAAGAAGCTGATAAAGCA
    CGCATCAAGTCATTTAAAAAATATAAAGATTATGTTGCCAAAAGCGCCTCTCAACAAAAT
    AAAGAAAACAATACAGAGGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    684

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0651 [new locus tag: NWMN_RS03695 ]
  • symbol: NWMN_0651
  • description: hypothetical protein
  • length: 227
  • theoretical pI: 10.6491
  • theoretical MW: 26686.6
  • GRAVY: -1.46432

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    FIG01108121: hypothetical protein 
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1574(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2152(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_0956hypothetical protein  [1] (data from MRSA252)
    NWMN_1184RNA-metabolising metallo-beta-lactamase  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.5
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.232
    • Ymax_pos: 26
    • Cmax: 0.145
    • Cmax_pos: 51
    • Smax: 0.592
    • Smax_pos: 3
    • Smean: 0.481
    • D: 0.329
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDKKKVIKFMINVLPIVLVPLIVERKRIKQHPDVQKVTDATSKVASKTSAAISNTASDVKEYVGDKKQDFENKRELKKFAREHDPAYIEKKGEKLAKQNRKDADKMNKILQKNIEKRHKEEQKAREKNEIQRIKDMKKSQKYEEKAGLTPNKLDEKTEKKGDKLAEKNRKEIAKMNKKLQKNIEKRHKEEQKRQQEADKARIKSFKKYKDYVAKSASQQNKENNTEA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SigB [2] [3] other strains
    SigB (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J. Bacteriol.: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]