From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0667 [new locus tag: NWMN_RS03775 ]
  • pan locus tag?: SAUPAN002582000
  • symbol: NWMN_0667
  • pan gene symbol?: fruR
  • synonym:
  • product: fructose operon transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0667 [new locus tag: NWMN_RS03775 ]
  • symbol: NWMN_0667
  • product: fructose operon transcriptional regulator
  • replicon: chromosome
  • strand: +
  • coordinates: 747671..748432
  • length: 762
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGATAATTACTGAAAAAAGACACGAGTTAATATTAGAAGAACTTTCGCACAAAGATTTT
    TTGACTTTACAAGAATTAATAGATCGAACTGGTTGCAGTGCTTCAACAATACGAAGAGAT
    TTATCTAAACTACAACAATTAGGGAAATTGCAACGTGTGCATGGTGGTGCAATGTTAAAA
    GAAAATCGTATGGTTGAGGCGAATTTAACTGAAAAATTAGCAACGAATCTTGATGAAAAG
    AAAATGATTGCTAAAATAGCAGCTAATCAAATCAACGATAATGAATGCTTATTTATCGAT
    GCTGGTTCATCTACATTGGAGCTAATTAAATATATTCAAGCGAAAGATATCATTGTGGTA
    ACCAATGGTTTAACACATGTAGAAGCTTTACTTAAAAAAGGTATTAAAACAATTATGCTA
    GGTGGTCAAGTTAAAGAAAATACACTTGCTACGATTGGTTCTAGTGCTATGGAGATATTA
    AGACGATATTGTTTCGATAAAGCTTTTATCGGGATGAATGGATTAGATATTGAACTTGGA
    TTAACTACTCCCGATGAGCAAGAGGCATTAGTTAAACAAACAGCAATGTCATTAGCCAAT
    CAATCATTTGTACTTATAGATCATTCTAAGTTTAATAAAGTATATTTTGCTCGTGTACCT
    TTGCTAGAAAGTACGACAATCATCACATCTGAAAAAGCATTAAATCAAGAATCGTTAAAA
    GAATACCAACAAAAGTATCACTTTATAGGAGGGACTTTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    762

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0667 [new locus tag: NWMN_RS03775 ]
  • symbol: NWMN_0667
  • description: fructose operon transcriptional regulator
  • length: 253
  • theoretical pI: 7.13005
  • theoretical MW: 28341.7
  • GRAVY: -0.130435

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionstrehalose operon repressor (TIGR02404; HMM-score: 16.5)
    noncanonical pyrimidine nucleotidase, YjjG family (TIGR02254; EC 3.1.3.5; HMM-score: 15.5)
    MetabolismEnergy metabolismAmino acids and amineshistidine utilization repressor (TIGR02018; HMM-score: 12.7)
    Signal transductionRegulatory functionsDNA interactionshistidine utilization repressor (TIGR02018; HMM-score: 12.7)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 12.7)
  • TheSEED:  
    CarbohydratesMonosaccharidesFructose utilization Transcriptional repressor of the fructose operon, DeoR family 
  • PFAM:
    ISOCOT_Fold (CL0246) DeoRC; DeoR C terminal sensor domain (PF00455; HMM-score: 164.4)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 59.1)
    HTH_11; HTH domain (PF08279; HMM-score: 35.1)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 24.9)
    HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 19.9)
    HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 19.6)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 18.4)
    MarR_2; MarR family (PF12802; HMM-score: 15.3)
    Linker_histone; linker histone H1 and H5 family (PF00538; HMM-score: 15)
    AbiEi_4; Transcriptional regulator, AbiEi antitoxin (PF13338; HMM-score: 14.8)
    HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 14.1)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 13.6)
    Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 13)
    HTH_9; RNA polymerase III subunit RPC82 helix-turn-helix domain (PF08221; HMM-score: 12.1)
    Mga; Mga helix-turn-helix domain (PF05043; HMM-score: 12.1)
    Met_repress (CL0057) SeqA_N; SeqA protein N-terminal domain (PF17206; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.101
    • Ymax_pos: 60
    • Cmax: 0.122
    • Cmax_pos: 35
    • Smax: 0.119
    • Smax_pos: 49
    • Smean: 0.079
    • D: 0.092
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MIITEKRHELILEELSHKDFLTLQELIDRTGCSASTIRRDLSKLQQLGKLQRVHGGAMLKENRMVEANLTEKLATNLDEKKMIAKIAANQINDNECLFIDAGSSTLELIKYIQAKDIIVVTNGLTHVEALLKKGIKTIMLGGQVKENTLATIGSSAMEILRRYCFDKAFIGMNGLDIELGLTTPDEQEALVKQTAMSLANQSFVLIDHSKFNKVYFARVPLLESTTIITSEKALNQESLKEYQQKYHFIGGTL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: NWMN_0667 (FruR*), CcpA
    FruR* (TF) important in Fructose utilization  RegPrecise
    CcpA (TF) important in Carbon catabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]