From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1048 [new locus tag: NWMN_RS05930 ]
  • pan locus tag?: SAUPAN003372000
  • symbol: NWMN_1048
  • pan gene symbol?:
  • synonym:
  • product: SpoU rRNA methylase family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1048 [new locus tag: NWMN_RS05930 ]
  • symbol: NWMN_1048
  • product: SpoU rRNA methylase family protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1150615..1151355
  • length: 741
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGAACAAATTACTTCTGCACAAAATAATAGAATTAAACAAGCGAACAAGCTAAAAAAG
    AAACGTGAGAGGGATAAAACTGGATTAGCTTTAATTGAAGGTGTGCATTTAATTGAAGAA
    GCTTATCAAAGTGGAATTGTAATTACACAATTATTTGCAATTGAACCGGCAAGATTAGAT
    CAGCAAATTATCGCATACGCGCAAGAAGTTTTTGAAATAAACATGAAAGTTGCTGAATCT
    TTATCAGGTACAGTGACACCACAAGGGTTTTTCGCAATCATTGAGAAGCCGCATTATGAT
    ATTTCTAAAGCACAACAAGTATTGCTCATCGATCGTGTTCAAGATCCTGGAAATTTAGGC
    ACATTAATTAGAACTGCGGATGCTGCTGGAATGGATGCTGTAATAATGGAGAAGGGTACG
    ACAGATCCTTATCAAGATAAAGTGTTGCGAGCGAGTCAAGGTAGTGTTTTCCATTTGCCA
    GTTATGACACAAGATCTCGATACGTTTATTACTCAATTTAATGGTCCTGTTTATGGTACA
    GCACTTGAAAACGCAGTGGCATACAAAGAAGTTACTTCAAGTGATTCTTTTGCATTACTA
    TTAGGTAATGAGGGAGAAGGTGTTAATCCTGAATTATTAGCACATACTACACAAAATTTA
    ATCATACCTATTTATGGTAAAGCTGAAAGTTTAAATGTAGCGATTGCAGGTAGTATTTTA
    CTTTATCATTTGAAAGGTTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    741

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1048 [new locus tag: NWMN_RS05930 ]
  • symbol: NWMN_1048
  • description: SpoU rRNA methylase family protein
  • length: 246
  • theoretical pI: 4.94869
  • theoretical MW: 26913.6
  • GRAVY: -0.0735772

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationRNA methyltransferase, TrmH family, group 3 (TIGR00186; HMM-score: 113.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (cytidine(34)-2'-O)-methyltransferase (TIGR00185; EC 2.1.1.207; HMM-score: 26.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationRNA methyltransferase, TrmH family, group 1 (TIGR00050; EC 2.1.1.-; HMM-score: 22)
  • TheSEED:  
    SpoU rRNA Methylase family protein 
  • PFAM:
    SPOUT (CL0098) SpoU_methylase; SpoU rRNA Methylase family (PF00588; HMM-score: 116.4)
    PELOTA (CL0101) SpoU_sub_bind; RNA 2'-O ribose methyltransferase substrate binding (PF08032; HMM-score: 42.6)
    TSNR_N; Thiostrepton-resistance methylase, N terminus (PF04705; HMM-score: 13.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.154
    • Ymax_pos: 15
    • Cmax: 0.132
    • Cmax_pos: 68
    • Smax: 0.307
    • Smax_pos: 13
    • Smean: 0.211
    • D: 0.176
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MEQITSAQNNRIKQANKLKKKRERDKTGLALIEGVHLIEEAYQSGIVITQLFAIEPARLDQQIIAYAQEVFEINMKVAESLSGTVTPQGFFAIIEKPHYDISKAQQVLLIDRVQDPGNLGTLIRTADAAGMDAVIMEKGTTDPYQDKVLRASQGSVFHLPVMTQDLDTFITQFNGPVYGTALENAVAYKEVTSSDSFALLLGNEGEGVNPELLAHTTQNLIIPIYGKAESLNVAIAGSILLYHLKG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]