From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2149 [new locus tag: NWMN_RS12410 ]
  • pan locus tag?: SAUPAN005699000
  • symbol: rplB
  • pan gene symbol?: rplB
  • synonym:
  • product: 50S ribosomal protein L2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2149 [new locus tag: NWMN_RS12410 ]
  • symbol: rplB
  • product: 50S ribosomal protein L2
  • replicon: chromosome
  • strand: -
  • coordinates: 2373078..2373911
  • length: 834
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCTATTAAAAAGTATAAGCCAATAACAAATGGTCGTCGTAATATGACTTCGTTAGAT
    TTCGCAGAAATCACGAAAACTACACCTGAAAAGTCATTATTAAAACCGCTACCGAAAAAA
    GCGGGACGTAACAACCAAGGTAAATTGACTGTAAGACACCATGGTGGTGGACACAAACGT
    CAATACCGTGTTATCGATTTCAAACGTAACAAAGATGGTATCAATGCAAAAGTTGATTCT
    ATTCAATATGATCCAAACCGCTCAGCAAACATCGCTTTAGTTGTATATGCAGACGGTGAA
    AAACGATATATCATTGCTCCTAAAGGATTAGAAGTAGGTCAAATCGTTGAAAGTGGTGCT
    GAAGCTGACATCAAAGTTGGTAACGCATTACCATTACAAAACATTCCAGTTGGTACAGTA
    GTACACAACATCGAGCTTAAACCTGGTAAAGGTGGACAAATCGCTCGTTCAGCTGGTGCA
    AGTGCTCAAGTACTTGGTAAAGAAGGTAAATACGTATTAATCAGATTAAGATCTGGTGAA
    GTTCGTATGATCTTATCTACTTGCCGTGCTACAATCGGTCAAGTTGGTAACCTACAACAC
    GAATTAGTTAACGTTGGTAAAGCCGGACGTTCAAGATGGAAAGGTATCCGTCCAACAGTT
    CGTGGTTCTGTAATGAACCCTAACGATCACCCACACGGTGGTGGTGAAGGTCGTGCTCCT
    ATCGGTAGACCATCTCCAATGTCACCATGGGGTAAACCTACGCTTGGTAAGAAAACTCGT
    CGTGGTAAAAAATCATCAGACAAACTTATCGTTCGTGGACGTAAGAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    834

Protein[edit source | edit]

Protein Data Bank: 5LI0
Protein Data Bank: 4WCE
Protein Data Bank: 4WFB
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 5HL7

General[edit source | edit]

  • locus tag: NWMN_2149 [new locus tag: NWMN_RS12410 ]
  • symbol: RplB
  • description: 50S ribosomal protein L2
  • length: 277
  • theoretical pI: 11.4477
  • theoretical MW: 30154.8
  • GRAVY: -0.664621

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein uL2 (TIGR01171; HMM-score: 460.3)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisRibosome LSU bacterial LSU ribosomal protein L2p (L8e) 
  • PFAM:
    KOW (CL0107) Ribosomal_L2_C; Ribosomal Proteins L2, C-terminal domain (PF03947; HMM-score: 192.1)
    OB (CL0021) Ribosomal_L2; Ribosomal Proteins L2, RNA binding domain (PF00181; HMM-score: 122.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_2163(fmhB)peptidoglycan pentaglycine interpeptide biosynthesis protein  [1] (data from MRSA252)
    NWMN_1206(glpP)glycerol uptake operon antiterminator regulatory protein  [1] (data from MRSA252)
    NWMN_0877(ppnK)inorganic polyphosphate/ATP-NAD kinase  [1] (data from MRSA252)
    NWMN_1536(relA)GTP pyrophosphokinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2145(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2144(rpmC)50S ribosomal protein L29  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0357(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2128(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_02495'-nucleotidase, lipoprotein e(P4) family protein  [1] (data from MRSA252)
    NWMN_0376hypothetical protein  [1] (data from MRSA252)
    NWMN_0956hypothetical protein  [1] (data from MRSA252)
    NWMN_1184RNA-metabolising metallo-beta-lactamase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1600universal stress protein family protein  [1] (data from MRSA252)
    NWMN_1631hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.174
    • Ymax_pos: 11
    • Cmax: 0.129
    • Cmax_pos: 33
    • Smax: 0.412
    • Smax_pos: 1
    • Smean: 0.285
    • D: 0.217
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAIKKYKPITNGRRNMTSLDFAEITKTTPEKSLLKPLPKKAGRNNQGKLTVRHHGGGHKRQYRVIDFKRNKDGINAKVDSIQYDPNRSANIALVVYADGEKRYIIAPKGLEVGQIVESGAEADIKVGNALPLQNIPVGTVVHNIELKPGKGGQIARSAGASAQVLGKEGKYVLIRLRSGEVRMILSTCRATIGQVGNLQHELVNVGKAGRSRWKGIRPTVRGSVMNPNDHPHGGGEGRAPIGRPSPMSPWGKPTLGKKTRRGKKSSDKLIVRGRKKK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29

Relevant publications[edit source | edit]