From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2215 [new locus tag: NWMN_RS12775 ]
  • pan locus tag?: SAUPAN005792000
  • symbol: NWMN_2215
  • pan gene symbol?: spdB
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2215 [new locus tag: NWMN_RS12775 ]
  • symbol: NWMN_2215
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2436664..2437401
  • length: 738
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    GTGGAAAATGAAAAAAAGAAATACACGTTTAAAGATATAGCATGGAGAGATTTGCTTATA
    ATTCCAATTATAGGTGTTATATTTTATGCACTCACAATTGCAGCTTACATAGGACCAATT
    TTGTTTGGTTATTATGAAATCGATAGTAATCTGATATTTGTAGCGACTATCACACAAGCT
    TTAGCATATACGATTGGGATTGGCGCATTTTATTTATTTCATTTAAAAGTGATGCCATCA
    AGGCTTCGAGCTGGTTTTGCGTATATCAAAAAATATTGGCTTAGATTGTCAATAACGTAT
    ATTATTGCTCTCATCTTAATTTATACATATGAATATATGACACAGTTTCTACCTAAACAT
    TTGCAATATAGTGAAACAGCCAATGAACTTGAGCTAAATAAAATGTTTGAAGTGCCTGCA
    TTTTTACCTGTAGCATTCTTATTAATTGTGATTGTAGGTCCAATAGTTGAAGAAATCGTA
    TTTAGACATATTTTAATTGGAGAATTAGGTAAGAAGTTTAATTTTATAGCTATGAGTATT
    GTTTCGGTGTTCTTATTTGCATTTATTCATGTGACTGATGCAAAGTCGCCGTTTGAGTTT
    GGTCCATATCTCATACTATCCATCATATTAGTTTTCACTTATTTAAAATCTGGAAGAAAC
    CTAGGTTCAACAATTGCATTACATATAGCAAATAATTTTGTTTCTTTCGTTATATCAGTA
    ATAAGTATTTATGCGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    738

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2215 [new locus tag: NWMN_RS12775 ]
  • symbol: NWMN_2215
  • description: hypothetical protein
  • length: 245
  • theoretical pI: 9.19765
  • theoretical MW: 28034.3
  • GRAVY: 0.82

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    Protein of pXO2-46 
  • PFAM:
    Peptidase_U (CL0472) Abi; CAAX protease self-immunity (PF02517; HMM-score: 52.5)
    no clan definedDUF2798; Protein of unknown function (DUF2798) (PF11391; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 7
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 11
    • Cmax: 0.166
    • Cmax_pos: 63
    • Smax: 0.162
    • Smax_pos: 1
    • Smean: 0.106
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 7

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MENEKKKYTFKDIAWRDLLIIPIIGVIFYALTIAAYIGPILFGYYEIDSNLIFVATITQALAYTIGIGAFYLFHLKVMPSRLRAGFAYIKKYWLRLSITYIIALILIYTYEYMTQFLPKHLQYSETANELELNKMFEVPAFLPVAFLLIVIVGPIVEEIVFRHILIGELGKKFNFIAMSIVSVFLFAFIHVTDAKSPFEFGPYLILSIILVFTYLKSGRNLGSTIALHIANNFVSFVISVISIYA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_2215 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Matthew B Frankel, Brandon M Wojcik, Andrea C DeDent, Dominique M Missiakas, Olaf Schneewind
ABI domain-containing proteins contribute to surface protein display and cell division in Staphylococcus aureus.
Mol. Microbiol.: 2010, 78(1);238-52
[PubMed:20923422] [WorldCat.org] [DOI] (I p)