From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2233 [new locus tag: NWMN_RS12870 ]
  • pan locus tag?: SAUPAN005819000
  • symbol: NWMN_2233
  • pan gene symbol?: hutR
  • synonym:
  • product: LysR family regulatory protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2233 [new locus tag: NWMN_RS12870 ]
  • symbol: NWMN_2233
  • product: LysR family regulatory protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2455941..2456825
  • length: 885
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAAATTATTCAGTTAGAATACTTCTTGGCTATCGTGAAATATAATAGTTTTACTAAA
    GCTGCACAATTTTTACATATTAGCCAGCCATCTTTAACTGCTACGATTAAAAAAATGGAA
    GCAGATTTAGGTTATGACTTATTTACACGTTCAACAAAAGACATCAAGATTACCGAAAAA
    GGAATACAGTTTTATCGTTATGCGAGCGAATTAGTTCAACAATATCGATCCACGATGGAA
    AAAATGTATGATTTAAGCGTTACATCAGAACCAAGGATAAAAATTGGGACTCTTGAATCT
    ACGAATCAATGGATTGCGAATTTAATTCGAAAGCACCATTCCGACTACCCTGAACAGCAA
    TATCGTTTATATGAAATACATGATAAACATCAATCTATAGAGCAATTACTGAATTTTAAT
    ATTCATTTAGCTATAACAAATGGAAAAATAACCCACGAAGATATAAGATCCATTCCTTTA
    TATGAGGAATCTTACATTTTATTAGCACCCAAGGAAACATTTAAAAATCAAAATTGGGTA
    GATGTTGAAAATTTGCCACTCATATTACCAAACAAAAATTCTCAAGTGCGCAAACACTTA
    GATGACTATTTTAATAGAAGAAATATTCGTCCAAATGTCGTTGTAGAAACAGATCGATTC
    GAATCAGCAGTTGGATTTGTTCATCTCGGCTTAGGTTACGCTATCATTCCGAGATTTTAT
    TACCAATCATTTCACACGTCTAATTTAGAATATAAAAAAATTCGTCCAAACTTAGGCCGA
    AAAATTTATATCAATTACCATAAAAAACGCAAACACTCCGAACAAGTACATACATTCGTA
    CAACAATGCCAAGATTATTTATATGGACTTTTAGAGGCTCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2233 [new locus tag: NWMN_RS12870 ]
  • symbol: NWMN_2233
  • description: LysR family regulatory protein
  • length: 294
  • theoretical pI: 9.4892
  • theoretical MW: 34945.7
  • GRAVY: -0.536395

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsaminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 92.4)
    MetabolismEnergy metabolismOtherpca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.4)
    Signal transductionRegulatory functionsDNA interactionspca operon transcription factor PcaQ (TIGR02424; HMM-score: 84.4)
    Cellular processesCellular processesToxin production and resistancetranscriptional regulator, ArgP family (TIGR03298; HMM-score: 54.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscriptional regulator, ArgP family (TIGR03298; HMM-score: 54.4)
    Signal transductionRegulatory functionsDNA interactionstranscriptional regulator, ArgP family (TIGR03298; HMM-score: 54.4)
    putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 44.3)
    Signal transductionRegulatory functionsDNA interactionsD-serine deaminase transcriptional activator (TIGR02036; HMM-score: 26.6)
    homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 13.4)
  • TheSEED:  
    LysR family regulatory protein 
  • PFAM:
    PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 114.4)
    HTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 64.3)
    NUMOD1; NUMOD1 domain (PF07453; HMM-score: 15.3)
    no clan definedLOH1CR12; Tumour suppressor protein (PF10158; HMM-score: 9.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_0515(capD)polysaccharide biosynthesis protein CapD  [1] (data from MRSA252)
    NWMN_1114(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1838(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_1937(groEL)chaperonin GroEL  [1] (data from MRSA252)
    NWMN_1348(ilvA)threonine dehydratase  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_2004(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_0700(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0463(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2145(rplP)50S ribosomal protein L16  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2138(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    NWMN_0722(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0346acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0651hypothetical protein  [1] (data from MRSA252)
    NWMN_0881enoyl-(acyl carrier protein) reductase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.175
    • Ymax_pos: 22
    • Cmax: 0.144
    • Cmax_pos: 22
    • Smax: 0.306
    • Smax_pos: 27
    • Smean: 0.195
    • D: 0.183
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIIQLEYFLAIVKYNSFTKAAQFLHISQPSLTATIKKMEADLGYDLFTRSTKDIKITEKGIQFYRYASELVQQYRSTMEKMYDLSVTSEPRIKIGTLESTNQWIANLIRKHHSDYPEQQYRLYEIHDKHQSIEQLLNFNIHLAITNGKITHEDIRSIPLYEESYILLAPKETFKNQNWVDVENLPLILPNKNSQVRKHLDDYFNRRNIRPNVVVETDRFESAVGFVHLGLGYAIIPRFYYQSFHTSNLEYKKIRPNLGRKIYINYHKKRKHSEQVHTFVQQCQDYLYGLLEAL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NWMN_2233 (HutR*)
    HutR* (TF) important in Histidine utilizationRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]