From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2405 [new locus tag: NWMN_RS13830 ]
  • pan locus tag?: SAUPAN006134000
  • symbol: NWMN_2405
  • pan gene symbol?: relP
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2405 [new locus tag: NWMN_RS13830 ]
  • symbol: NWMN_2405
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2647126..2647818
  • length: 693
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGTATGTAGATCGAAAACCATCACTATATTTAGAGGATTTGCGACATGATTTTAAAAAT
    AGTTTAAGTAAATTTGAAAATGGTGATGAAGCATTTGATACGTTATTAGGTTTCGTAGAG
    TTAGATCATATTTATTCGTCAGCACTAAAGGAAATAAGCACTAAACTGAGTATTTTAGAT
    GACAATTTCAATCACATTTATAAACACAATCCTATACATCATATGGAGCGACGTGTGAAA
    GAAATGCGTAGTTTAATAGAAAAGCTTAATCGTAAAGGATTACAGATTAGCGCAGAAACT
    GCCAAAGAACATATACTGGATATTGCCGGAATTCGCGTAGTATGTAATTACTTAGATGAT
    ATTTATTTGATTGAAGAGATGTTGCTTAAACAAGAAGACGTACAATTGATAAAACGTAAA
    GATTATATTCAGCACCCTAAAGAAAATGGTTACCGCAGTTTACATATCGTTGTATCTATT
    CCAGTCTTTTTAGCAGAACGCGTTGAGGTATTGCCTGTTGAAATTCAAATTAGAACGATA
    GGTATGGATATGTGGGCAAGTTTAGAACATAAAATACGTTATAAAAACAATGCAGAGACG
    GAAAAGTATCGAGATTTACTGAAAGAATGTGCGACAGAGATTACTGAAGTTGAAGATAAA
    TTACAACAAATTCATTCTGAAATAACAGAGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    693

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2405 [new locus tag: NWMN_RS13830 ]
  • symbol: NWMN_2405
  • description: hypothetical protein
  • length: 230
  • theoretical pI: 5.77612
  • theoretical MW: 27165
  • GRAVY: -0.47087

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionsRelA/SpoT family protein (TIGR00691; HMM-score: 59.7)
  • TheSEED:  
    CBSS-222523.1.peg.1311 GTP pyrophosphokinase (EC 2.7.6.5) 
  • PFAM:
    NTP_transf (CL0260) RelA_SpoT; Region found in RelA / SpoT proteins (PF04607; HMM-score: 128.8)
    Traffic (CL0147) V-SNARE; Vesicle transport v-SNARE protein N-terminus (PF05008; HMM-score: 15.5)
    no clan definedUvsW; ATP-dependant DNA helicase UvsW (PF11637; HMM-score: 14.2)
    RNase_H2-Ydr279; Ydr279p protein family (RNase H2 complex component) (PF09468; HMM-score: 14)
    DUF4140; N-terminal domain of unknown function (DUF4140) (PF13600; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 32
    • Cmax: 0.124
    • Cmax_pos: 32
    • Smax: 0.12
    • Smax_pos: 19
    • Smean: 0.093
    • D: 0.102
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYVDRKPSLYLEDLRHDFKNSLSKFENGDEAFDTLLGFVELDHIYSSALKEISTKLSILDDNFNHIYKHNPIHHMERRVKEMRSLIEKLNRKGLQISAETAKEHILDIAGIRVVCNYLDDIYLIEEMLLKQEDVQLIKRKDYIQHPKENGYRSLHIVVSIPVFLAERVEVLPVEIQIRTIGMDMWASLEHKIRYKNNAETEKYRDLLKECATEITEVEDKLQQIHSEITE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Tobias Geiger, Benjamin Kästle, Fabio Lino Gratani, Christiane Goerke, Christiane Wolz
Two small (p)ppGpp synthases in Staphylococcus aureus mediate tolerance against cell envelope stress conditions.
J. Bacteriol.: 2014, 196(4);894-902
[PubMed:24336937] [WorldCat.org] [DOI] (I p)