From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2548 [new locus tag: NWMN_RS14635 ]
  • pan locus tag?: SAUPAN006382000
  • symbol: NWMN_2548
  • pan gene symbol?: secA2
  • synonym:
  • product: preprotein translocase subunit SecA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2548 [new locus tag: NWMN_RS14635 ]
  • symbol: NWMN_2548
  • product: preprotein translocase subunit SecA
  • replicon: chromosome
  • strand: -
  • coordinates: 2809742..2812132
  • length: 2391
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    ATGAAACATAAACTAGATGTTACGATAAACGAATTAAGACTAAAGTCGATTAGAAAAATA
    GTGAAACGCATCAATACATGGAGCGATGAAGTTAAATCATATTCTGATGATGCGTTAAAA
    CAAAAGACAATAGAATTTAAAGAACGTTTAGCATCAGGAGTTGATACACTAGATACATTG
    TTACCTGAAGCTTATGCAGTGGCACGTGAAGCGAGCTGGAGAGTATTAGGTATGTATCCT
    AAAGAAGTTCAGTTAATCGGAGCGATTGTATTGCATGAAGGTAACATTGCGGAGATGCAA
    ACAGGCGAAGGTAAAACATTAACGGCAACGATGCCTTTATATTTAAATGCTCTTTCGGGA
    AAAGGAACATATTTAATTACAACGAATGATTATTTAGCGAAGCGAGATTTTGAAGAGATG
    CAACCATTATATGAATGGTTAGGTTTAACTGCTTCATTAGGTTTTGTTGATATTGTGGAT
    TATGAGTATCAAAAAGGGGAAAAACGTAATATATATGAACATGATATTATATATACAACT
    AATGGACGTCTCGGTTTTGATTATTTAATTGATAATTTGGCTGATAGTGCGGAAGGGAAA
    TTTTTACCACAATTAAATTACGGTATTATTGATGAAGTGGATTCAATCATTTTAGATGCT
    GCTCAAACACCATTAGTTATTTCGGGTGCACCAAGATTACAATCAAATCTATTTCATATT
    GTGAAAGAGTTTGTAGATACATTGATTGAAGACGTGCATTTTAAAATGAAGAAGACCAAA
    AAAGAAATATGGCTGTTAAATCAAGGTATTGAAGCGGCACAATCATACTTTAATGTTGAA
    GATTTATATAGCGAACAAGCGATGGTCCTAGTGCGTAATATTAATTTAGCACTGCGCGCA
    CAATATTTGTTTGAATCTAATGTCGATTACTTTGTATATAATGGTGATATTGTTTTAATT
    GACCGTATTACAGGTCGTATGTTACCGGGAACTAAGTTGCAAGCTGGACTTCACCAAGCT
    ATTGAAGCGAAAGAAGGTATGGAGGTTTCAACAGATAAAAGTGTTATGGCAACAATTACC
    TTCCAGAATTTATTTAAACTTTTTGAATCATTTTCAGGTATGACAGCTACAGGAAAATTA
    GGCGAATCAGAGTTCTTTGATTTGTATTCAAAAATAGTCGTACAAGTACCAACTGATAAA
    GCGATTCAACGTATCGATGAACCAGATAAAGTGTTTCGTTCAGTTGATGAGAAAAACATC
    GCGATGATTCATGATATAGTTGAACTTCATGAAACGGGGCGACCGGTTTTACTCATAACG
    AGAACTGCTGAAGCGGCTGAATACTTTTCGAAAGTATTATTCCAAATGGATATTCCTAAT
    AATTTACTCATTGCGCAAAATGTTGCAAAAGAAGCGCAGATGATAGCTGAAGCAGGGCAA
    ATTGGTTCCATGACTGTTGCGACTAGTATGGCAGGTCGAGGCACAGATATTAAACTTGGT
    GAAGGTGTCGAAGCATTAGGTGGATTAGCTGTTATTATTCATGAACATATGGAAAATAGC
    CGTGTAGACAGGCAATTACGTGGTCGTTCTGGTAGACAAGGGGATCCGGGATCATCTTGT
    ATATATATTTCACTAGATGATTATTTAGTTAAGCGATGGAGCGATAGTAATTTAGCGGAA
    AATAATCAATTATATTCATTAGATGCACAACGATTATCGCAAAGTAATTTGTTTAATCGC
    AAAGTTAAGCAAATTGTAGTTAAAGCGCAGCGTATCTCGGAAGAACAAGGGGTTAAAGCT
    CGTGAAATGGCTAATGAATTTGAAAAAAGCATTAGTATACAGCGAGATCTTGTATACGAG
    GAACGCAATCGAGTTTTAGAAATAGATGATGCTGAGAATCAAGATTTTAAAGCGTTAGCT
    AAAGATGTATTTGAAATGTTTGTAAATGAGGAAAAGGTGCTAACAAAATCGCGTGTTGTC
    GAGTATATTTATCAAAATTTAAGTTTCCAATTTAATAAAGATGTGGCTTGTGTTAATTTT
    AAAGATAAGCAAGCAGTAGTGACATTTTTATTAGAGCAATTTGAAAAGCAATTAGCTTTG
    AATCGTAAAAACATGCAAAGTGCATATTATTATAATATTTTCGTTCAAAAAGTCTTTTTG
    AAAGCAATTGATTCATGTTGGTTAGAACAAGTCGACTATTTACAACAATTAAAAGCAAGC
    GTTAATCAACGACAAAATGGGCAACGTAACGCTATTTTTGAATACCATAGAGTTGCCTTA
    GATTCATTTGAAGTTATGACACGAAATATCAAAAAAAGAATGGTGAAAAATATTTGTCAA
    AGCATGATTACATTTGATAAAGAGGGTATGCCAGTTATACATTTTCCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2391

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2548 [new locus tag: NWMN_RS14635 ]
  • symbol: NWMN_2548
  • description: preprotein translocase subunit SecA
  • length: 796
  • theoretical pI: 5.29414
  • theoretical MW: 90929.4
  • GRAVY: -0.265704

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingaccessory Sec system translocase SecA2 (TIGR03714; HMM-score: 1241.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, SecA subunit (TIGR00963; HMM-score: 689.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingaccessory Sec system translocase SecA2 (TIGR04397; HMM-score: 668.9)
    accessory Sec system translocase SecA2 (TIGR04221; HMM-score: 484.6)
  • TheSEED:  
    Membrane TransportProtein translocation across cytoplasmic membraneSecY2-SecA2 Specialized Transport System Protein export cytoplasm protein SecA2 ATPase RNA helicase (TC 3.A.5.1.1) 
    CBSS-393121.3.peg.2760 Protein export cytoplasm protein SecA2 ATPase RNA helicase (TC 3.A.5.1.1) 
  • PFAM:
    P-loop_NTPase (CL0023) SecA_DEAD; SecA DEAD-like domain (PF07517; HMM-score: 340.6)
    no clan definedSecA_PP_bind; SecA preprotein cross-linking domain (PF01043; HMM-score: 91.1)
    SecA_SW; SecA Wing and Scaffold domain (PF07516; HMM-score: 88.1)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 27.7)
    no clan definedMrx7; MIOREX complex component 7 (PF10906; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_0359(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    NWMN_1325(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.146
    • Ymax_pos: 14
    • Cmax: 0.109
    • Cmax_pos: 69
    • Smax: 0.267
    • Smax_pos: 4
    • Smean: 0.215
    • D: 0.173
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKHKLDVTINELRLKSIRKIVKRINTWSDEVKSYSDDALKQKTIEFKERLASGVDTLDTLLPEAYAVAREASWRVLGMYPKEVQLIGAIVLHEGNIAEMQTGEGKTLTATMPLYLNALSGKGTYLITTNDYLAKRDFEEMQPLYEWLGLTASLGFVDIVDYEYQKGEKRNIYEHDIIYTTNGRLGFDYLIDNLADSAEGKFLPQLNYGIIDEVDSIILDAAQTPLVISGAPRLQSNLFHIVKEFVDTLIEDVHFKMKKTKKEIWLLNQGIEAAQSYFNVEDLYSEQAMVLVRNINLALRAQYLFESNVDYFVYNGDIVLIDRITGRMLPGTKLQAGLHQAIEAKEGMEVSTDKSVMATITFQNLFKLFESFSGMTATGKLGESEFFDLYSKIVVQVPTDKAIQRIDEPDKVFRSVDEKNIAMIHDIVELHETGRPVLLITRTAEAAEYFSKVLFQMDIPNNLLIAQNVAKEAQMIAEAGQIGSMTVATSMAGRGTDIKLGEGVEALGGLAVIIHEHMENSRVDRQLRGRSGRQGDPGSSCIYISLDDYLVKRWSDSNLAENNQLYSLDAQRLSQSNLFNRKVKQIVVKAQRISEEQGVKAREMANEFEKSISIQRDLVYEERNRVLEIDDAENQDFKALAKDVFEMFVNEEKVLTKSRVVEYIYQNLSFQFNKDVACVNFKDKQAVVTFLLEQFEKQLALNRKNMQSAYYYNIFVQKVFLKAIDSCWLEQVDYLQQLKASVNQRQNGQRNAIFEYHRVALDSFEVMTRNIKKRMVKNICQSMITFDKEGMPVIHFP

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SigB [2] other strains
    SigB (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]