From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS00230 [old locus tag: NWMN_0038 ]
  • pan locus tag?: SAUPAN000148000
  • symbol: NWMN_RS00230
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS00230 [old locus tag: NWMN_0038 ]
  • symbol: NWMN_RS00230
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 49489..50091
  • length: 603
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (49489..50091) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGTTAATTAGTCTTGTAATCCCAGTTTTTGCTTTGTTAGTTATTGGTGGTATTATTTGG
    ATGATTATAGAAGGTATAGTACATATTTCAAAAAAGAATAAAGCAATTGATAACTTTTTT
    AACCAAGTTAATAAAGTAAGTGAGACATATAAATTCGCTACTACTTTTTTATTTCTAATC
    TTGGCTACGGCTGGTATTTCTCAATTTTATCTATATTATATAGTATCAGCGTTTCTTTTT
    TGGCTTGTCATACTTACCTTTGGCATTGCAGGTATCATTTTTTTAATGCCATATGGATTA
    TGTTTTCTACCGTTTTATAAGCAAAAAAAGAAAAAACAGACATTTAAAAAATACATGGTT
    TACACTACGATTGGTTTGTCAATTTGTCTAGGCTTATCTCTAGTTTTGGTTCACACTACG
    AAAATTTATATGGACGAAGGTGGCGTAAGATACTATTACGGTAGTTTTGTAATGAAACAA
    GCGGGCGGTTATGCTTATTTAGCTTTAGCGGTACTTTCAACGTTGTTAATTGTTGCGAAA
    AAAGCTACAAATAAAAATAAAGAAATCGAAACCGTCGACAATACAAATATAACGGAAAGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    603

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS00230 [old locus tag: NWMN_0038 ]
  • symbol: NWMN_RS00230
  • description: hypothetical protein
  • length: 200
  • theoretical pI: 9.95595
  • theoretical MW: 22662.1
  • GRAVY: 0.665

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    integral membrane protein (TIGR04561; HMM-score: 12.7)
  • TheSEED:
  • PFAM:
    no clan definedTM2; TM2 domain (PF05154; HMM-score: 14.1)
    DUF2611; Protein of unknown function (DUF2611) (PF11022; HMM-score: 12.9)
    M11L; Apoptosis regulator M11L like (PF11099; HMM-score: 11.3)
    Vpu; Vpu protein (PF00558; HMM-score: 9.4)
    COX7C; Cytochrome c oxidase subunit VIIc (PF02935; HMM-score: 8.4)
    CPP1-like; Protein CHAPERONE-LIKE PROTEIN OF POR1-like (PF11833; HMM-score: 7.5)
    O-anti_assembly (CL0499) Wzy_C; O-Antigen ligase (PF04932; HMM-score: 6.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.221
    • Ymax_pos: 36
    • Cmax: 0.234
    • Cmax_pos: 36
    • Smax: 0.443
    • Smax_pos: 1
    • Smean: 0.195
    • D: 0.211
  • predicted transmembrane helices (TMHMM): 5

Accession numbers[edit source | edit]

  • GI: 446831696 NCBI
  • RefSeq: WP_000908952 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLISLVIPVFALLVIGGIIWMIIEGIVHISKKNKAIDNFFNQVNKVSETYKFATTFLFLILATAGISQFYLYYIVSAFLFWLVILTFGIAGIIFLMPYGLCFLPFYKQKKKKQTFKKYMVYTTIGLSICLGLSLVLVHTTKIYMDEGGVRYYYGSFVMKQAGGYAYLALAVLSTLLIVAKKATNKNKEIETVDNTNITER

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS00230 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]