From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS00320 [old locus tag: NWMN_0056 ]
  • pan locus tag?: SAUPAN000910000
  • symbol: NWMN_RS00320
  • pan gene symbol?: sarS
  • synonym:
  • product: transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS00320 [old locus tag: NWMN_0056 ]
  • symbol: NWMN_RS00320
  • product: transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 75375..76127
  • length: 753
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (75375..76127) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAATATAATAACCATGACAAAATTAGAGATTTTATAATCATTGAAGCATATATGTTT
    CGTTTTAAGAAAAAAGTCAAGCCTGAAGTCGATATGACTATAAAAGAATTTATATTACTG
    ACTTATTTATTTCATCAGCAAGAAAACACACTTCCATTTAAGAAGATTGTTTCAGATTTA
    TGTTATAAACAATCGGATTTAGTACAGCATATAAAAGTACTTGTGAAACATTCATATATT
    AGTAAAGTTCGAAGTAAAATTGATGAGCGTAATACTTACATTTCAATATCTGAAGAACAA
    CGAGAGAAAATTGCAGAACGTGTTACATTGTTTGATCAAATCATTAAACAATTTAACCTT
    GCAGATCAAAGTGAATCACAGATGATACCAAAAGATAGTAAAGAATTTCTAAACTTGATG
    ATGTATACAATGTATTTCAAGAATATTATCAAAAAACATCTAACATTAAGTTTTGTAGAA
    TTCACAATTCTAGCTATTATCACTTCTCAAAATAAAAACATCGTTCTTCTTAAAGATTTA
    ATTGAAACAATCCACCATAAATACCCTCAAACTGTTAGAGCTCTCAATAATTTAAAAAAG
    CAAGGCTATCTAATAAAAGAACGCTCAACTGAAGATGAAAGAAAAATTTTAATTCATATG
    GATGACGCGCAGCAAGACCATGCTGAACAATTATTAGCTCAAGTGAATCAATTATTAGCA
    GATAAAGATCATTTACATCTTGTTTTTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    753

Protein[edit source | edit]

Protein Data Bank: 1P4X

General[edit source | edit]

  • locus tag: NWMN_RS00320 [old locus tag: NWMN_0056 ]
  • symbol: NWMN_RS00320
  • description: transcriptional regulator
  • length: 250
  • theoretical pI: 9.31072
  • theoretical MW: 29889.6
  • GRAVY: -0.3956

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsstaphylococcal accessory regulator family (TIGR01889; HMM-score: 214.6)
    homoprotocatechuate degradation operon regulator, HpaR (TIGR02337; HMM-score: 33.3)
    mobile rSAM pair MarR family regulator (TIGR04472; HMM-score: 14.8)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 14.3)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsputative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13.7)
  • TheSEED:
  • PFAM:
    HTH (CL0123) MarR; MarR family (PF01047; HMM-score: 32.7)
    MarR_2; MarR family (PF12802; HMM-score: 30.4)
    Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 25.7)
    HTH_27; Winged helix DNA-binding domain (PF13463; HMM-score: 22.1)
    HTH_34; Winged helix DNA-binding domain (PF13601; HMM-score: 19.2)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 14.6)
    no clan definedLectin_N; Hepatic lectin, N-terminal domain (PF03954; HMM-score: 13.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.103
    • Ymax_pos: 29
    • Cmax: 0.132
    • Cmax_pos: 29
    • Smax: 0.114
    • Smax_pos: 69
    • Smean: 0.075
    • D: 0.092
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446799500 NCBI
  • RefSeq: WP_000876756 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKYNNHDKIRDFIIIEAYMFRFKKKVKPEVDMTIKEFILLTYLFHQQENTLPFKKIVSDLCYKQSDLVQHIKVLVKHSYISKVRSKIDERNTYISISEEQREKIAERVTLFDQIIKQFNLADQSESQMIPKDSKEFLNLMMYTMYFKNIIKKHLTLSFVEFTILAIITSQNKNIVLLKDLIETIHHKYPQTVRALNNLKKQGYLIKERSTEDERKILIHMDDAQQDHAEQLLAQVNQLLADKDHLHLVFE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS00320 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]