From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS00535 [old locus tag: NWMN_0095 ]
  • pan locus tag?: SAUPAN000974000
  • symbol: NWMN_RS00535
  • pan gene symbol?: capA
  • synonym:
  • product: capsular polysaccharide type 5 biosynthesis protein cap5A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS00535 [old locus tag: NWMN_0095 ]
  • symbol: NWMN_RS00535
  • product: capsular polysaccharide type 5 biosynthesis protein cap5A
  • replicon: chromosome
  • strand: +
  • coordinates: 119469..120137
  • length: 669
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (119469..120137) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTACATTAGAATTAACAAAAATTAAAGAAGTATTACAAAAAAACTTGAAGATT
    TTAATTATTTTACCGCTATTATTTTTAATTATTAGCGCTATTGTTACATTTTTCGTCTTA
    TCACCTAAATATCAAGCTAATACTCAAATTTTAGTGAATCAAACTAAGGGTGACAATCCT
    CAGTTTATGGCGCAAGAGGTTCAAAGTAATATTCAACTTGTAAATACGTATAAAGAAATT
    GTTAAAAGTCCTAGAATTTTAGATGAGGTGTCAAAGGACTTAAATGATAAGTATTCACCA
    TCTAAATTGTCGAGTATGTTGACAATTACAAACCAAGAAAATACGCAACTTATCAACATC
    CAAGTTAAAAGTGGTCATAAACAAGATTCGGAAAAAATTGCGAATAGCTTCGCTAAAGTT
    ACAAGTAAACAAATTCCGAAGATTATGAGTGTGGATAACGTATCAATTTTATCTAAAGCA
    GACGGTACAGCAGTTAAAGTCGCACCAAAAACTGTAGTGAATCTAATCGGTGCATTCTTT
    TTAGGATTAGTTGTCGCGCTTATATATATCTTCTTCAAAGTAATTTTCGATAAGCGAATT
    AAAGATGAAGAAGATGTAGAGAAAGAATTAGGATTGCCTGTATTGGGTTCAATTCAAAAA
    TTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS00535 [old locus tag: NWMN_0095 ]
  • symbol: NWMN_RS00535
  • description: capsular polysaccharide type 5 biosynthesis protein cap5A
  • length: 222
  • theoretical pI: 9.86158
  • theoretical MW: 24854
  • GRAVY: 0.0869369

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidspolysaccharide export protein, MPA1 family (TIGR01006; HMM-score: 322.3)
    chain length determinant protein EpsF (TIGR03017; HMM-score: 42)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsexopolysaccharide transport protein family (TIGR01005; HMM-score: 30.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidespolysaccharide chain length determinant protein, PEP-CTERM locus subfamily (TIGR03007; HMM-score: 16.2)
    HAD hydrolase, TIGR01459 family (TIGR01459; HMM-score: 12.9)
  • TheSEED:
  • PFAM:
    no clan definedWzz; Chain length determinant protein (PF02706; HMM-score: 82.7)
    GNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 24.4)
    LapA_dom; Lipopolysaccharide assembly protein A domain (PF06305; HMM-score: 13.3)
    DUF1189; Protein of unknown function (DUF1189) (PF06691; HMM-score: 12.5)
    DUF2663; Protein of unknown function (DUF2663) (PF10864; HMM-score: 11.9)
    DUF5469; Family of unknown function (DUF5469) (PF17561; HMM-score: 10.4)
    DUF3671; Protein of unknown function (PF12420; HMM-score: 6.8)
    DUF3985; Protein of unknown function (DUF3985) (PF13153; HMM-score: 6.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.245
    • Ymax_pos: 47
    • Cmax: 0.189
    • Cmax_pos: 47
    • Smax: 0.624
    • Smax_pos: 43
    • Smean: 0.189
    • D: 0.223
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446368444 NCBI
  • RefSeq: WP_000446299 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MESTLELTKIKEVLQKNLKILIILPLLFLIISAIVTFFVLSPKYQANTQILVNQTKGDNPQFMAQEVQSNIQLVNTYKEIVKSPRILDEVSKDLNDKYSPSKLSSMLTITNQENTQLINIQVKSGHKQDSEKIANSFAKVTSKQIPKIMSVDNVSILSKADGTAVKVAPKTVVNLIGAFFLGLVVALIYIFFKVIFDKRIKDEEDVEKELGLPVLGSIQKFN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS00535 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]