From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS00625 [old locus tag: NWMN_0113 ]
  • pan locus tag?: SAUPAN001003000
  • symbol: NWMN_RS00625
  • pan gene symbol?: aldA
  • synonym:
  • product: aldehyde dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS00625 [old locus tag: NWMN_0113 ]
  • symbol: NWMN_RS00625
  • product: aldehyde dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 137245..138732
  • length: 1488
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (137245..138732) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGCAGTAAACGTTCGAGATTATATTGCAGAGAATTATGGTTTATTTATCAATGGGGAA
    TTTGTTAAAGGTAGCAGTGACGAAACAATCGAAGTGACTAATCCAGCAACTGGAGAAACA
    CTATCACATATTACAAGAGCAAAAGATAAAGATGTCGATCATGCAGTCAAAGTGGCGCAA
    GAGGCATTTGAATCATGGTCATTAACTTCTAAATCAGAACGTGCACAAATGTTGCGTGAT
    ATTGGTGATAAATTAATGGCACAAAAAGATAAAATTGCAATGATTGAAACATTAAATAAT
    GGTAAACCGATTCGTGAGACAACAGCAATTGATATTCCATTTGCTGCAAGACATTTCCAT
    TATTTCGCAAGTGTTATTGAAACAGAAGAAGGTACAGTGAATGATATCGATAAAGACACA
    ATGAGTATCGTACGACATGAGCCGATTGGCGTCGTAGGTGCTGTTGTTGCTTGGAACTTC
    CCAATGCTATTAGCTGCATGGAAGATTGCGCCAGCCATTGCTGCAGGTAATACAATTGTG
    ATTCAACCTTCGTCTTCAACACCATTAAGTTTATTGGAAGTTGCTAAAATTTTCCAAGAG
    GTATTACCTAAAGGTGTTGTCAATATACTAACGGGTAAAGGTTCAGAATCAGGTAATGCA
    ATTTTCAATCATGATGGTGTAGATAAATTATCATTTACGGGCTCAACTGATGTAGGTTAT
    CAAGTTGCCGAAGCTGCAGCAAAACATCTAGTACCCGCTACATTAGAGCTTGGTGGTAAA
    AGCGCCAATATCATATTAGATGATGCTAATTTAGACCTTGCAGTTGAAGGTATTCAGTTA
    GGTATTTTATTCAACCAAGGTGAAGTATGTAGTGCAGGTTCTCGATTATTAGTTCATGAA
    AAAATTTATGATCAATTGGTGCCACGTTTACAAGAGGCATTTTCAAATATTAAAGTTGGA
    AATCCACAAGATGAAGCTACACAAATGGGTAGTCAAACTGGTAAGGATCAATTAGATAAA
    ATTCAATCATATATTGATGCAGCAAAAGAATCAGATGCACAAATTTTAGCAGGCGGTCAT
    CGCTTAACTGAAAATGGATTAGATAAAGGGTTCTTCTTTGAGCCGACATTAATTGCTGTG
    CCAGACAATCATCACAAATTAGCACAAGAAGAAATATTTGGACCAGTGTTAACAGTGATT
    AAAGTGAAGGACGATCAAGAAGCAATTGATATAGCTAATGATTCTGAGTATGGTTTAGCA
    GGCGGTGTATTTTCTCAAAATATCACACGTGCATTAAATATTGCTAAAGCTGTACGTACA
    GGACGTATTTGGATTAACACTTACAACCAAGTACCAGAAGGCGCACCATTTGGTGGTTAT
    AAAAAATCAGGTATCGGTCGAGAAACTTATAAAGGTGCGTTAAGTAACTATCAACAAGTT
    AAAAATATTTATATTGATACAAGCAATGCTTTAAAAGGTTTGTACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1488

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS00625 [old locus tag: NWMN_0113 ]
  • symbol: NWMN_RS00625
  • description: aldehyde dehydrogenase
  • length: 495
  • theoretical pI: 4.90708
  • theoretical MW: 53658.2
  • GRAVY: -0.171717

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionsbetaine-aldehyde dehydrogenase (TIGR01804; EC 1.2.1.8; HMM-score: 518.9)
    5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase (TIGR02299; EC 1.2.1.60; HMM-score: 439.6)
    MetabolismEnergy metabolismOther2-hydroxymuconic semialdehyde dehydrogenase (TIGR03216; EC 1.2.1.-; HMM-score: 379.4)
    MetabolismCentral intermediary metabolismOthersuccinate-semialdehyde dehydrogenase (TIGR01780; EC 1.2.1.-; HMM-score: 369.5)
    1-pyrroline dehydrogenase (TIGR03374; EC 1.2.1.19; HMM-score: 367.9)
    Unknown functionEnzymes of unknown specificityaldehyde dehydrogenase, Rv0768 family (TIGR04284; EC 1.2.1.-; HMM-score: 349.7)
    MetabolismEnergy metabolismAmino acids and aminesputative delta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01237; EC 1.2.1.88; HMM-score: 308.7)
    MetabolismEnergy metabolismAmino acids and aminesmethylmalonate-semialdehyde dehydrogenase (acylating) (TIGR01722; EC 1.2.1.27; HMM-score: 248.5)
    putative phosphonoacetaldehyde dehydrogenase (TIGR03250; EC 1.2.1.-; HMM-score: 234.3)
    MetabolismEnergy metabolismAmino acids and aminessuccinylglutamate-semialdehyde dehydrogenase (TIGR03240; EC 1.2.1.71; HMM-score: 226.9)
    MetabolismEnergy metabolismAmino acids and aminesdelta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01238; EC 1.2.1.88; HMM-score: 192.6)
    MetabolismEnergy metabolismAmino acids and amines1-pyrroline-5-carboxylate dehydrogenase (TIGR01236; EC 1.2.1.88; HMM-score: 183.5)
    phenylacetic acid degradation protein paaN (TIGR02278; HMM-score: 122.3)
    acetaldehyde dehydrogenase (acetylating) (TIGR02518; EC 1.2.1.10; HMM-score: 42.7)
    phenylacetic acid degradation protein paaN (TIGR02288; HMM-score: 30.3)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate-5-semialdehyde dehydrogenase (TIGR00407; EC 1.2.1.41; HMM-score: 26.5)
  • TheSEED:
  • PFAM:
    ALDH-like (CL0099) Aldedh; Aldehyde dehydrogenase family (PF00171; HMM-score: 575.7)
    LuxC; Acyl-CoA reductase (LuxC) (PF05893; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 39
    • Cmax: 0.134
    • Cmax_pos: 25
    • Smax: 0.151
    • Smax_pos: 24
    • Smean: 0.094
    • D: 0.106
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446212545 NCBI
  • RefSeq: WP_000290400 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAVNVRDYIAENYGLFINGEFVKGSSDETIEVTNPATGETLSHITRAKDKDVDHAVKVAQEAFESWSLTSKSERAQMLRDIGDKLMAQKDKIAMIETLNNGKPIRETTAIDIPFAARHFHYFASVIETEEGTVNDIDKDTMSIVRHEPIGVVGAVVAWNFPMLLAAWKIAPAIAAGNTIVIQPSSSTPLSLLEVAKIFQEVLPKGVVNILTGKGSESGNAIFNHDGVDKLSFTGSTDVGYQVAEAAAKHLVPATLELGGKSANIILDDANLDLAVEGIQLGILFNQGEVCSAGSRLLVHEKIYDQLVPRLQEAFSNIKVGNPQDEATQMGSQTGKDQLDKIQSYIDAAKESDAQILAGGHRLTENGLDKGFFFEPTLIAVPDNHHKLAQEEIFGPVLTVIKVKDDQEAIDIANDSEYGLAGGVFSQNITRALNIAKAVRTGRIWINTYNQVPEGAPFGGYKKSGIGRETYKGALSNYQQVKNIYIDTSNALKGLY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS00625 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]