From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS02990 [old locus tag: NWMN_0515 ]
  • pan locus tag?: SAUPAN002325000
  • symbol: NWMN_RS02990
  • pan gene symbol?:
  • synonym:
  • product: UDP-glucose 4-epimerase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS02990 [old locus tag: NWMN_0515 ]
  • symbol: NWMN_RS02990
  • product: UDP-glucose 4-epimerase
  • replicon: chromosome
  • strand: +
  • coordinates: 594401..595366
  • length: 966
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (594401..595366) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAAAAAAATTATGATTACTGGTGCATTAGGACAAATTGGTACAGAATTAGTTGTTAAG
    TGCAGAGAAATTTATGGGACAGATAATGTTCTTGCTACAGATATTAGGGAACCTGAAGCA
    GACTCACCTGTACAAAATGGACCATTTGAAATCTTAGACGTAACAGATCGTGACCGTATG
    TTTGAGTTAGTTAGGGACTTTGAAGCGGATAGTCTAATGCATATGGCAGCATTATTATCA
    GCAACTGCTGAGAAAAATCCAATTCTAGCTTGGGATTTAAATATGGGTGGATTAATGAAT
    GCATTAGAAGCTGCAAGAACTTATAATTTGCACTTTTTCACACCAAGTTCAATTGGTGCA
    TTTGGAGACTCAACTCCTAAAGTTAATACGCCACAAGTAACGATTCAGCAACCTACGACA
    ATGTATGGTGTAAATAAAGTAGCTGGAGAATTATTGTGTCAATACTATTTCAAACGTTTT
    GGTGTAGATACAAGAAGTGTTAGATTCCCAGGTTTAATCTCGCATGTTAAAGAGCCAGGT
    GGCGGTACTACAGACTATGCTGTTGAAATATACTTCAAAGCAGTAAGAGAGGGTCATTAT
    ACAAGCTTCATAGATAAAGGCACGTATATGGATATGATGTATATGGATGATGCAATTGAA
    GCAATTATTAAACTTATGGAAGCAGACGACGCTAAATTAGAAACTAGAAATGGTTATAAT
    TTGAGCGCAATGAGTTTTGATCCAGAGATGGTAAAAGAAGCAATTCAAGAATACTATCCC
    AATTTTACATTAGATTACGATGTTGATCCTATTAGACAAGGTATCGCTAATAGTTGGCCG
    GATTCTATTGATACAAGCTGTTCACGTGGCGAATGGGGATTTGATCCTAAATATGATTTA
    GCGAGCATGACTAAATTAATGTTAGAAGCTATTGAACAAAAAGATACTGTTAAAAATAAT
    AACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    966

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS02990 [old locus tag: NWMN_0515 ]
  • symbol: NWMN_RS02990
  • description: UDP-glucose 4-epimerase
  • length: 321
  • theoretical pI: 4.35464
  • theoretical MW: 36052.7
  • GRAVY: -0.311526

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 44.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 39.5)
    MetabolismEnergy metabolismSugarsUDP-glucose 4-epimerase GalE (TIGR01179; EC 5.1.3.2; HMM-score: 30.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-glucose 4,6-dehydratase (TIGR01181; EC 4.2.1.46; HMM-score: 30.1)
    NAD dependent epimerase/dehydratase, LLPSF_EDH_00030 family (TIGR04180; HMM-score: 21.6)
    UDP-N-acetylglucosamine 4,6-dehydratase (inverting) (TIGR03589; EC 4.2.1.115; HMM-score: 21.5)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesCDP-glucose 4,6-dehydratase (TIGR02622; EC 4.2.1.45; HMM-score: 20)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 88.8)
    GDP_Man_Dehyd; GDP-mannose 4,6 dehydratase (PF16363; HMM-score: 56.3)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 43.7)
    Polysacc_synt_2; Polysaccharide biosynthesis protein (PF02719; HMM-score: 35.8)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 22.3)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 16.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS0657530S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_RS14560arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.129
    • Ymax_pos: 22
    • Cmax: 0.157
    • Cmax_pos: 33
    • Smax: 0.222
    • Smax_pos: 18
    • Smean: 0.153
    • D: 0.138
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446645955 NCBI
  • RefSeq: WP_000723301 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKIMITGALGQIGTELVVKCREIYGTDNVLATDIREPEADSPVQNGPFEILDVTDRDRMFELVRDFEADSLMHMAALLSATAEKNPILAWDLNMGGLMNALEAARTYNLHFFTPSSIGAFGDSTPKVNTPQVTIQQPTTMYGVNKVAGELLCQYYFKRFGVDTRSVRFPGLISHVKEPGGGTTDYAVEIYFKAVREGHYTSFIDKGTYMDMMYMDDAIEAIIKLMEADDAKLETRNGYNLSAMSFDPEMVKEAIQEYYPNFTLDYDVDPIRQGIANSWPDSIDTSCSRGEWGFDPKYDLASMTKLMLEAIEQKDTVKNNN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS02990 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]