From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS03190 [old locus tag: NWMN_0557 ]
  • pan locus tag?: SAUPAN002375000
  • symbol: NWMN_RS03190
  • pan gene symbol?:
  • synonym:
  • product: dihydrolipoamide dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS03190 [old locus tag: NWMN_0557 ]
  • symbol: NWMN_RS03190
  • product: dihydrolipoamide dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 640618..641940
  • length: 1323
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (640618..641940) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGAAAACATATGATTTAATTGTAATAGGATTTGGGAAAGCTGGTAAAACTTTAGCGAAA
    TACGCTGCATCAACAGGTCAACACGTCGCAGTTATCGAACAATCTCCGAAAATGTATGGA
    GGCACTTGTATAAACATAGGATGTATACCTTCGAAGACACTTGTACATGATGGATTAGAA
    GGCAAATCTTTTGAAGCAAGTTATAACCGTAAAAACGATGTTGTCAATGCGCTAAACAAT
    AAAAATTACCACTTATTAGCAGACGATAACAACATTGATGTACTGGATTTTAAAGCGCAG
    TTTAAATCTAATACTGAAGTGAATTTATTAGATCAACATGACGATATCGTCGATAGTATT
    ACTGCACCTCATATCATTATTAATACCGGTGCTACCTCTGTCATTCCTAACATTAAAGGC
    CTTGATCAAGCTAAACACGTCTTCGATTCGACAGGTTTATTAAACATTAGCTATCAACCT
    AAGCACCTCGTTATTGTAGGTGGCGGTTATATCGCCTTAGAATTTGCTTCAATGTTTGCG
    AATTTAGGTAGTAAGGTAACAGTATTAGAACGTGGCGAATCATTTATGCCACGCGAAGAT
    CAAGATGTCGTTGCATATGGTATTACTGACTTAGAAAATAAAGGCATTGCATTGCATACA
    AATGTTGAAACGACTGAATTGTCATCTGACAATCATCATACAACAGTCCATACCAACGTT
    GATAACTTTGAGGCTGATGCAGTACTTTTGGCTATCGGGCGCAAACCGAATACGGATTTA
    GCTTTAGAAAATACTGATATCGAATTAGGCGACAGAGGCGAAATTAAAGTCAATGCTCAT
    CTTCAAACAACTGTGCCGCATATTTATGCTGCAGGTGATGTTAAAGGCGGACTTCAATTT
    ACGTATATATCTTTAGATGATTATCGAATTATCAAATCAGCGTTATATGGTAATCAGTCA
    CGTACGACTGACAATAGAGGCAGCGTGCCTTATACAGTATTTATAGATCCACCATTATCA
    CGTGTTGGATTAACTAGTAAAGAAGCTGCCGCTCAACATTATGATTACACTGAACATCAA
    CTTTTAGTAAGTGCTATACCTCGTCATAAAATTAACAATGATCCAAGAGGTTTATTTAAA
    GTAGTCATTAATAATGAAAATAATATGATTTTAGGTGCTACATTATATGGTAAGCAATCT
    GAAGAATTAATTAATATAATTAAACTTGCGATTGATCAAAACATTCCATATACCGTATTA
    CGAGATAATATTTATACGCATCCTACGATGGCCGAATCATTTAATGATTTATTTAATTTC
    TAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1323

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS03190 [old locus tag: NWMN_0557 ]
  • symbol: NWMN_RS03190
  • description: dihydrolipoamide dehydrogenase
  • length: 440
  • theoretical pI: 5.65506
  • theoretical MW: 48473.2
  • GRAVY: -0.234318

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 319.9)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 307.9)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 241.3)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 203.6)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 203.3)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 159)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 151.6)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 120)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 89.1)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 76.5)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 60.4)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 60.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 57.3)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 49.8)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.2)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 47.4)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 39)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 37.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 36.4)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 33.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 31.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 30.7)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 28.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 24.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 23.3)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 20.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 19.5)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 17.9)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 17.5)
    Genetic information processingProtein fateProtein folding and stabilizationxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 17)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 17)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 16.5)
    Cellular processesCellular processesSporulation and germinationdipicolinic acid synthetase, A subunit (TIGR02853; HMM-score: 16)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 15.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 14.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.4)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 14.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 13.9)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 13.6)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 13.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 12.3)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 203.3)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 81.9)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 80.7)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 53.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 33.7)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 29.7)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 27.5)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 27.1)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 25.7)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 25.6)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 23.7)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 23.6)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 23.1)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 21.7)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 21.4)
    Thi4; Thi4 family (PF01946; HMM-score: 20.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 19.9)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.4)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.4)
    no clan definedDUF2704; Protein of unknown function (DUF2704) (PF10866; HMM-score: 15.8)
    NADP_Rossmann (CL0063) UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15.4)
    Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.205
    • Ymax_pos: 23
    • Cmax: 0.13
    • Cmax_pos: 23
    • Smax: 0.412
    • Smax_pos: 21
    • Smean: 0.285
    • D: 0.236
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446783325 NCBI
  • RefSeq: WP_000860581 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKTYDLIVIGFGKAGKTLAKYAASTGQHVAVIEQSPKMYGGTCINIGCIPSKTLVHDGLEGKSFEASYNRKNDVVNALNNKNYHLLADDNNIDVLDFKAQFKSNTEVNLLDQHDDIVDSITAPHIIINTGATSVIPNIKGLDQAKHVFDSTGLLNISYQPKHLVIVGGGYIALEFASMFANLGSKVTVLERGESFMPREDQDVVAYGITDLENKGIALHTNVETTELSSDNHHTTVHTNVDNFEADAVLLAIGRKPNTDLALENTDIELGDRGEIKVNAHLQTTVPHIYAAGDVKGGLQFTYISLDDYRIIKSALYGNQSRTTDNRGSVPYTVFIDPPLSRVGLTSKEAAAQHYDYTEHQLLVSAIPRHKINNDPRGLFKVVINNENNMILGATLYGKQSEELINIIKLAIDQNIPYTVLRDNIYTHPTMAESFNDLFNF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS03190 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]