From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS04120 [old locus tag: NWMN_0727 ]
  • pan locus tag?: SAUPAN002676000
  • symbol: NWMN_RS04120
  • pan gene symbol?: uvrA
  • synonym:
  • product: excinuclease ABC subunit A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS04120 [old locus tag: NWMN_0727 ]
  • symbol: NWMN_RS04120
  • product: excinuclease ABC subunit A
  • replicon: chromosome
  • strand: +
  • coordinates: 816428..819274
  • length: 2847
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (816428..819274) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    ATGAAAGAACCATCCATAGTAGTAAAAGGTGCTCGTGCGCATAACTTGAAAGATATTGAT
    ATCGAACTACCTAAAAATAAATTAATTGTTATGACAGGTTTATCTGGGTCAGGTAAATCG
    TCATTAGCATTCGATACTATATATGCTGAAGGACAACGACGTTATGTTGAATCATTAAGT
    GCCTATGCGCGTCAATTTTTAGGCCAAATGGACAAACCAGATGTTGATACAATTGAAGGA
    TTATCGCCAGCAATTTCAATAGATCAAAAAACAACAAGTAAAAATCCAAGATCAACTGTA
    GCAACAGTAACAGAAATATATGATTATATACGTTTGTTATATGCACGTGTTGGTAAACCT
    TACTGTCCAAATCACAATATAGAAATTGAATCGCAAACAGTACAACAAATGGTTGACCGC
    ATTATGGAATTAGAGGCACGTACAAAGATTCAATTATTAGCACCTGTCATCGCTCATCGT
    AAAGGTAGTCATGAAAAGCTAATCGAAGATATTGGTAAAAAAGGTTATGTACGTTTAAGA
    ATCGATGGCGAAATTGTTGATGTAAATGATGTACCTACTTTAGATAAGAACAAGAATCAT
    ACAATAGAAGTTGTTGTAGACCGATTAGTTGTTAAAGATGGAATTGAAACACGACTAGCT
    GACTCTATAGAAACTGCCTTAGAGCTTTCAGAAGGACAATTAACAGTCGATGTCATTGAC
    GGGGAAGACCTTAAGTTTTCAGAAAGCCATGCTTGTCCTATATGTGGATTTTCAATCGGA
    GAGTTAGAACCAAGAATGTTTAGCTTTAACAGTCCTTTTGGTGCTTGTCCGACATGTGAT
    GGCTTAGGCCAAAAGTTAACAGTCGATGTAGACTTGGTTGTTCCCGACAAAGATAAGACG
    CTAAACGAAGGTGCAATAGAACCTTGGATACCGACGAGTTCTGATTTTTATCCAACATTG
    TTAAAACGTGTTTGTGAAGTTTATAAAATCAATATGGATAAACCTTTTAAAAAGTTAACA
    GAACGTCAACGTGATATTTTATTGTATGGTTCTGGTGACAAAGAAATTGAATTTACATTT
    ACACAACGTCAAGGTGGTACTAGAAAACGAACAATGGTTTTCGAGGGTGTAGTTCCTAAT
    ATAAGTAGACGATTCCATGAATCTCCTTCAGAATATACACGTGAAATGATGAGTAAATAT
    ATGACTGAACTACCTTGCGAAACTTGTCATGGAAAGCGATTGAGTCGTGAAGCGTTATCT
    GTTTATGTAGGTGGTTTAAATATTGGTGAAGTAGTCGAATATTCAATCAGTCAAGCGCTG
    AACTATTATAAAAACATTGATTTGTCAGAACAAGATCAAGCGATTGCAAATCAAATATTG
    AAAGAAATTATTTCCCGACTCACTTTTTTAAATAATGTGGGACTTGAATATTTAACGTTA
    AACAGAGCTTCAGGTACACTTTCAGGTGGTGAAGCACAACGTATTCGATTAGCAACGCAA
    ATTGGGTCGCGTTTGACTGGTGTCTTATATGTATTAGATGAGCCATCAATTGGACTGCAT
    CAAAGAGATAATGATCGATTAATTAATACACTTAAAGAAATGAGAGATTTAGGAAATACT
    TTAATTGTAGTTGAACACGATGATGATACAATGCGTGCGGCTGATTACTTAGTGGATATA
    GGTCCTGGTGCTGGTGAACATGGAGGGCAGATTGTGTCTAGTGGTACTCCTCAAAAGGTA
    ATGAAAGATAAAAAATCATTAACAGGACAATACTTGAGTGGTAAGAAACGTATTGAAGTA
    CCTGAATATCGCAGACCGGCTTCAGATCGTAAAATTTCTATACGTGGAGCTAGAAGCAAC
    AATCTTAAAGGGGTTGATGTGGACATACCACTATCAATCATGACGGTTGTTACAGGTGTA
    TCAGGTTCTGGTAAAAGCTCATTAGTAAATGAAGTATTATACAAATCATTAGCTCAAAAA
    ATTAATAAATCTAAAGTAAAGCCAGGATTGTACGATAAGATTGAAGGTATTGATCAACTT
    GATAAAATTATTGATATTGATCAATCACCAATAGGTAGAACGCCACGCTCTAATCCAGCA
    ACATATACTGGTGTGTTTGATGATATACGTGATGTGTTTGCGCAAACAAATGAAGCTAAA
    ATTCGAGGATATCAAAAAGGGCGTTTTAGTTTTAATGTAAAAGGTGGACGCTGTGAAGCT
    TGTAAAGGTGACGGTATTATTAAAATTGAAATGCATTTTTTACCTGATGTTTATGTTCCT
    TGTGAAGTGTGTGATGGTAAACGATATAATCGTGAGACACTAGAGGTTACTTACAAAGGT
    AAAAATATTGCTGACATTTTAGAAATGACTGTTGAAGAAGCAACACAATTTTTTGAAAAT
    ATTCCTAAGATTAAGCGCAAGTTACAAACACTAGTTGATGTTGGTCTTGGATACGTCACA
    TTAGGTCAACAAGCTACAACGTTATCAGGTGGTGAGGCTCAACGTGTGAAACTTGCATCT
    GAACTTCATAAACGTTCAACTGGTAAATCTATTTATATCCTAGATGAACCGACAACAGGG
    TTACATGTTGACGATATTAGTAGATTATTAAAAGTATTAAACCGATTAGTTGAAAATGGT
    GATACTGTTGTAATTATTGAACATAACCTAGATGTTATCAAAACAGCAGACTATATTATA
    GACTTAGGTCCTGAAGGTGGTAGTGGCGGTGGTACTATTGTTGCGACTGGCACACCCGAA
    GATATTGCTCAGACAAAGTCATCATATACAGGAAAGTATTTAAAAGAAGTACTTGAACGA
    GATAAACAAAATACTGAAGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2847

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS04120 [old locus tag: NWMN_0727 ]
  • symbol: NWMN_RS04120
  • description: excinuclease ABC subunit A
  • length: 948
  • theoretical pI: 6.2809
  • theoretical MW: 105367
  • GRAVY: -0.386287

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 1496)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 118.5)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 114.3)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 109.9)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 109.9)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 102.6)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 101.6)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 95.6)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 91.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 89)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 81.3)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 79.5)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 78.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 75.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 72.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 72.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 71.3)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 69.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68.4)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68.4)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 68)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 66.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 62.6)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 61.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 61.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 61.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 59.9)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 59.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 59.3)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 59.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 58.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.5)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.5)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 58.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 58.1)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 58.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 57.4)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 55.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 55.6)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 55.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 52.9)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 50.5)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 50.5)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 49.5)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 49.5)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 48.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 47.9)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 46.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 46.4)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 46.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 43)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 40.4)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 39.9)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 39.6)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 39.6)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 39.3)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 39.3)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 38.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 38.4)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 35.9)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 35.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 31.5)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 30.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 27.7)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 22.8)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 21.4)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 20.8)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 18.6)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 17.4)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 17.4)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 16.9)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 16.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 15.6)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 14.1)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 12.4)
    Genetic information processingTranscriptionRNA processingpolynucleotide kinase-phosphatase (TIGR04075; HMM-score: 10.5)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 68.9)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 48.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 29.9)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.5)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 27.4)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 23.6)
    no clan definedDnaJ_CXXCXGXG; DnaJ central domain (PF00684; HMM-score: 23.5)
    P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 23.2)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 22.4)
    AAA_33; AAA domain (PF13671; HMM-score: 22.2)
    AAA_22; AAA domain (PF13401; HMM-score: 21.2)
    AAA_14; AAA domain (PF13173; HMM-score: 19.4)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 19.3)
    AAA_18; AAA domain (PF13238; HMM-score: 17.3)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 16.4)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.4)
    DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 15.3)
    Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 15.3)
    AAA_24; AAA domain (PF13479; HMM-score: 15.1)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
    NACHT; NACHT domain (PF05729; HMM-score: 13.8)
    ATPase; KaiC (PF06745; HMM-score: 13.6)
    AAA_25; AAA domain (PF13481; HMM-score: 13.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.1)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 11.2)
    no clan definedAnti-TRAP; Tryptophan RNA-binding attenuator protein inhibitory protein (PF15777; HMM-score: 10.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.148
    • Ymax_pos: 44
    • Cmax: 0.137
    • Cmax_pos: 44
    • Smax: 0.288
    • Smax_pos: 42
    • Smean: 0.105
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446585335 NCBI
  • RefSeq: WP_000662681 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKEPSIVVKGARAHNLKDIDIELPKNKLIVMTGLSGSGKSSLAFDTIYAEGQRRYVESLSAYARQFLGQMDKPDVDTIEGLSPAISIDQKTTSKNPRSTVATVTEIYDYIRLLYARVGKPYCPNHNIEIESQTVQQMVDRIMELEARTKIQLLAPVIAHRKGSHEKLIEDIGKKGYVRLRIDGEIVDVNDVPTLDKNKNHTIEVVVDRLVVKDGIETRLADSIETALELSEGQLTVDVIDGEDLKFSESHACPICGFSIGELEPRMFSFNSPFGACPTCDGLGQKLTVDVDLVVPDKDKTLNEGAIEPWIPTSSDFYPTLLKRVCEVYKINMDKPFKKLTERQRDILLYGSGDKEIEFTFTQRQGGTRKRTMVFEGVVPNISRRFHESPSEYTREMMSKYMTELPCETCHGKRLSREALSVYVGGLNIGEVVEYSISQALNYYKNIDLSEQDQAIANQILKEIISRLTFLNNVGLEYLTLNRASGTLSGGEAQRIRLATQIGSRLTGVLYVLDEPSIGLHQRDNDRLINTLKEMRDLGNTLIVVEHDDDTMRAADYLVDIGPGAGEHGGQIVSSGTPQKVMKDKKSLTGQYLSGKKRIEVPEYRRPASDRKISIRGARSNNLKGVDVDIPLSIMTVVTGVSGSGKSSLVNEVLYKSLAQKINKSKVKPGLYDKIEGIDQLDKIIDIDQSPIGRTPRSNPATYTGVFDDIRDVFAQTNEAKIRGYQKGRFSFNVKGGRCEACKGDGIIKIEMHFLPDVYVPCEVCDGKRYNRETLEVTYKGKNIADILEMTVEEATQFFENIPKIKRKLQTLVDVGLGYVTLGQQATTLSGGEAQRVKLASELHKRSTGKSIYILDEPTTGLHVDDISRLLKVLNRLVENGDTVVIIEHNLDVIKTADYIIDLGPEGGSGGGTIVATGTPEDIAQTKSSYTGKYLKEVLERDKQNTEDK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS04120 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]