From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

⊟Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS04305 [old locus tag: NWMN_0761 ]
  • pan locus tag?: SAUPAN002802000
  • symbol: NWMN_RS04305
  • pan gene symbol?: cspC
  • synonym:
  • product: cold-shock protein

⊟Genome View[edit source | edit]

⊟Gene[edit source | edit]

⊟General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS04305 [old locus tag: NWMN_0761 ]
  • symbol: NWMN_RS04305
  • product: cold-shock protein
  • replicon: chromosome
  • strand: +
  • coordinates: 857867..858067
  • length: 201
  • essential: unknown

⊟Accession numbers[edit source | edit]

  • Location: NC_009641 (857867..858067) NCBI
  • MicrobesOnline:

⊟Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    ATGAATAACGGTACAGTTAAATGGTTTAATGCAGAAAAAGGTTTTGGTTTCATCGAAAGA
    GAAGATGGTAGCGACGTATTCGTACACTTCTCAGCAATCGCTGAAGATGGATACAAATCA
    TTAGAAGAAGGCCAAAAAGTTGAATTCGACATCGTTGAAGGCGACCGTGGCGAGCAAGCT
    GCAAACGTAGTTAAAATGTAA
    60
    120
    180
    201

⊟Protein[edit source | edit]

⊟General[edit source | edit]

  • locus tag: NWMN_RS04305 [old locus tag: NWMN_0761 ]
  • symbol: NWMN_RS04305
  • description: cold-shock protein
  • length: 66
  • theoretical pI: 4.18132
  • theoretical MW: 7374.06
  • GRAVY: -0.513636

⊟Function[edit source | edit]

  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionscold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repaircold shock domain protein CspD (TIGR02381; HMM-score: 91.9)
    and 1 more
    Genetic information processingTranscriptionDegradation of RNAVacB and RNase II family 3'-5' exoribonucleases (TIGR00358; EC 3.1.13.1; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    OB (CL0021) CSD; 'Cold-shock' DNA-binding domain (PF00313; HMM-score: 108.8)
    and 2 more
    S1; S1 RNA binding domain (PF00575; HMM-score: 18)
    OB_RNB; Ribonuclease B OB domain (PF08206; HMM-score: 15.8)

⊟Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

⊟Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.099
    • Ymax_pos: 61
    • Cmax: 0.116
    • Cmax_pos: 35
    • Smax: 0.127
    • Smax_pos: 2
    • Smean: 0.073
    • D: 0.089
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit source | edit]

  • GI: 446981826 NCBI
  • RefSeq: WP_001059082 NCBI
  • UniProt:

⊟Protein sequence[edit source | edit]

  • MNNGTVKWFNAEKGFGFIEREDGSDVFVHFSAIAEDGYKSLEEGQKVEFDIVEGDRGEQAANVVKM

⊟Experimental data[edit source | edit]

  • experimentally validated: no data available

⊟Expression & Regulation[edit source | edit]

⊟Operon[edit source | edit]

  • NWMN_RS04305 no polycistronic organisation predicted

⊟Regulation[edit source | edit]

  • sigma factor:
  • regulator:

⊟Transcription pattern[edit source | edit]

⊟Protein synthesis (provided by Aureolib)[edit source | edit]

⊟Protein stability[edit source | edit]

  • half-life: no data available

⊟Biological Material[edit source | edit]

⊟Mutants[edit source | edit]

⊟Expression vector[edit source | edit]

⊟lacZ fusion[edit source | edit]

⊟GFP fusion[edit source | edit]

⊟two-hybrid system[edit source | edit]

⊟FLAG-tag construct[edit source | edit]

⊟Antibody[edit source | edit]

⊟Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

⊟Literature[edit source | edit]

⊟References[edit source | edit]

⊟Relevant publications[edit source | edit]

Retrieved from "https://aureowiki.med.uni-greifswald.de/index.php?title=NWMN_RS04305&oldid=78239"