From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05930 [old locus tag: NWMN_1048 ]
  • pan locus tag?: SAUPAN003372000
  • symbol: NWMN_RS05930
  • pan gene symbol?:
  • synonym:
  • product: RNA methyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS05930 [old locus tag: NWMN_1048 ]
  • symbol: NWMN_RS05930
  • product: RNA methyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 1150615..1151355
  • length: 741
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1150615..1151355) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGAACAAATTACTTCTGCACAAAATAATAGAATTAAACAAGCGAACAAGCTAAAAAAG
    AAACGTGAGAGGGATAAAACTGGATTAGCTTTAATTGAAGGTGTGCATTTAATTGAAGAA
    GCTTATCAAAGTGGAATTGTAATTACACAATTATTTGCAATTGAACCGGCAAGATTAGAT
    CAGCAAATTATCGCATACGCGCAAGAAGTTTTTGAAATAAACATGAAAGTTGCTGAATCT
    TTATCAGGTACAGTGACACCACAAGGGTTTTTCGCAATCATTGAGAAGCCGCATTATGAT
    ATTTCTAAAGCACAACAAGTATTGCTCATCGATCGTGTTCAAGATCCTGGAAATTTAGGC
    ACATTAATTAGAACTGCGGATGCTGCTGGAATGGATGCTGTAATAATGGAGAAGGGTACG
    ACAGATCCTTATCAAGATAAAGTGTTGCGAGCGAGTCAAGGTAGTGTTTTCCATTTGCCA
    GTTATGACACAAGATCTCGATACGTTTATTACTCAATTTAATGGTCCTGTTTATGGTACA
    GCACTTGAAAACGCAGTGGCATACAAAGAAGTTACTTCAAGTGATTCTTTTGCATTACTA
    TTAGGTAATGAGGGAGAAGGTGTTAATCCTGAATTATTAGCACATACTACACAAAATTTA
    ATCATACCTATTTATGGTAAAGCTGAAAGTTTAAATGTAGCGATTGCAGGTAGTATTTTA
    CTTTATCATTTGAAAGGTTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    741

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS05930 [old locus tag: NWMN_1048 ]
  • symbol: NWMN_RS05930
  • description: RNA methyltransferase
  • length: 246
  • theoretical pI: 4.94869
  • theoretical MW: 26913.6
  • GRAVY: -0.0735772

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationRNA methyltransferase, TrmH family, group 3 (TIGR00186; HMM-score: 113.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (cytidine(34)-2'-O)-methyltransferase (TIGR00185; EC 2.1.1.207; HMM-score: 26.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationRNA methyltransferase, TrmH family, group 1 (TIGR00050; EC 2.1.1.-; HMM-score: 22)
  • TheSEED:
  • PFAM:
    SPOUT (CL0098) SpoU_methylase; SpoU rRNA Methylase family (PF00588; HMM-score: 116.4)
    PELOTA (CL0101) SpoU_sub_bind; RNA 2'-O ribose methyltransferase substrate binding (PF08032; HMM-score: 42.6)
    TSNR_N; Thiostrepton-resistance methylase, N terminus (PF04705; HMM-score: 13.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.154
    • Ymax_pos: 15
    • Cmax: 0.132
    • Cmax_pos: 68
    • Smax: 0.307
    • Smax_pos: 13
    • Smean: 0.211
    • D: 0.176
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446357519 NCBI
  • RefSeq: WP_000435374 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MEQITSAQNNRIKQANKLKKKRERDKTGLALIEGVHLIEEAYQSGIVITQLFAIEPARLDQQIIAYAQEVFEINMKVAESLSGTVTPQGFFAIIEKPHYDISKAQQVLLIDRVQDPGNLGTLIRTADAAGMDAVIMEKGTTDPYQDKVLRASQGSVFHLPVMTQDLDTFITQFNGPVYGTALENAVAYKEVTSSDSFALLLGNEGEGVNPELLAHTTQNLIIPIYGKAESLNVAIAGSILLYHLKG

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS05930 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]