From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06470 [old locus tag: NWMN_1147 ]
  • pan locus tag?: SAUPAN003524000
  • symbol: NWMN_RS06470
  • pan gene symbol?: ffh
  • synonym:
  • product: signal recognition particle protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06470 [old locus tag: NWMN_1147 ]
  • symbol: NWMN_RS06470
  • product: signal recognition particle protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1257890..1259257
  • length: 1368
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1257890..1259257) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGGCATTTGAAGGGTTATCAGAACGCTTGCAAGCGACGATGCAAAAAATGCGTGGTAAG
    GGTAAACTTACTGAAGCTGATATAAAGATAATGATGCGTGAAGTAAGATTAGCGTTACTT
    GAGGCTGACGTAAACTTTAAAGTGGTAAAAGAATTTATTAAAACAGTATCAGAACGCGCA
    TTAGGTTCCGATGTAATGCAATCATTAACACCAGGGCAACAAGTTATTAAAATAGTTCAA
    GATGAATTAACGCAGTTGATGGGTGGAGAAAATACGTCGATTAATATGTCAAATAAACCA
    CCTACTGTTGTTATGATGGTTGGTTTACAAGGTGCTGGTAAAACAACAACTGCAGGTAAA
    TTAGCATTATTGATGCGTAAAAAATACAACAAAAAACCTATGTTAGTTGCAGCAGATATT
    TATCGTCCAGCAGCGATAAATCAATTACAAACAGTAGGGAAACAAATTGATATTCCTGTA
    TACAGTGAAGGAGATCAAGTAAAGCCACAACAAATTGTAACTAATGCATTAAAACATGCT
    AAAGAAGAACATTTAGACTTTGTAATCATTGATACAGCAGGTCGATTACACATCGATGAA
    GCATTGATGAACGAATTAAAAGAAGTAAAAGACATTGCTAAACCAAACGAAATTATGTTA
    GTTGTCGATTCAATGACGGGTCAAGATGCTGTCAATGTTGCAGAATCTTTTGACGATCAA
    CTTGATGTCACAGGTGTTACCTTAACTAAATTAGATGGTGATACACGTGGTGGTGCAGCT
    TTATCTATTCGTTCGGTGACACAAAAACCAATTAAATTTGTTGGTATGAGTGAAAAGTTA
    GATGGTTTAGAGCTATTCCATCCTGAACGTATGGCATCACGTATTTTAGGTATGGGTGAT
    GTGTTAAGTTTAATTGAAAAAGCGCAACAAGATGTGGATCAAGAAAAAGCAAAAGATTTA
    GAGAAAAAGATGCGTGAGTCATCGTTTACTTTAGATGATTTTTTAGAACAACTTGATCAG
    GTGAAAAATCTAGGACCACTGGATGATATTATGAAAATGATTCCAGGTATGAATAAAATG
    AAAGGGCTAGATAAGCTTAATATGAGTGAAAAGCAAATTGATCATATTAAAGCGATTATC
    CAGTCAATGACGCCGGCTGAAAGAAACAATCCAGACACATTGAATGTATCACGTAAAAAG
    CGTATTGCTAAAGGGTCTGGTCGTTCATTACAAGAAGTCAATCGTTTGATGAAACAATTT
    AACGATATGAAGAAAATGATGAAACAGTTCACTGGTGGCGGTAAAGGTAAAAAAGGTAAA
    CGCAATCAAATGCAAAATATGTTAAAAGGTATGAATTTACCGTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1368

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06470 [old locus tag: NWMN_1147 ]
  • symbol: NWMN_RS06470
  • description: signal recognition particle protein
  • length: 455
  • theoretical pI: 9.98774
  • theoretical MW: 50705
  • GRAVY: -0.414066

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle protein (TIGR00959; HMM-score: 628.7)
    signal recognition particle protein SRP54 (TIGR01425; HMM-score: 308.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 232.5)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 68.2)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 21.3)
    MetabolismEnergy metabolismPhotosynthesisphotosystem II biogenesis protein Psp29 (TIGR03060; HMM-score: 17.2)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 15)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.3)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 257.2)
    no clan definedSRP_SPB; Signal peptide binding domain (PF02978; HMM-score: 119.6)
    SRP54_N; SRP54-type protein, helical bundle domain (PF02881; HMM-score: 78.1)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 24.2)
    AAA_17; AAA domain (PF13207; HMM-score: 22.6)
    AAA_33; AAA domain (PF13671; HMM-score: 19.5)
    AAA_22; AAA domain (PF13401; HMM-score: 19.5)
    AAA_31; AAA domain (PF13614; HMM-score: 17.4)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 16.8)
    AAA_30; AAA domain (PF13604; HMM-score: 16.6)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 15.3)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 14.4)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.4)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 14.3)
    6PF2K; 6-phosphofructo-2-kinase (PF01591; HMM-score: 13.6)
    AAA_25; AAA domain (PF13481; HMM-score: 13.5)
    HTH (CL0123) Tn7_Tnp_TnsA_C; TnsA endonuclease C terminal (PF08721; HMM-score: 13.2)
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 12.7)
    AAA_24; AAA domain (PF13479; HMM-score: 9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 8.2)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 6.5)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.121
    • Ymax_pos: 20
    • Cmax: 0.111
    • Cmax_pos: 20
    • Smax: 0.153
    • Smax_pos: 10
    • Smean: 0.116
    • D: 0.119
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446786223 NCBI
  • RefSeq: WP_000863479 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAFEGLSERLQATMQKMRGKGKLTEADIKIMMREVRLALLEADVNFKVVKEFIKTVSERALGSDVMQSLTPGQQVIKIVQDELTQLMGGENTSINMSNKPPTVVMMVGLQGAGKTTTAGKLALLMRKKYNKKPMLVAADIYRPAAINQLQTVGKQIDIPVYSEGDQVKPQQIVTNALKHAKEEHLDFVIIDTAGRLHIDEALMNELKEVKDIAKPNEIMLVVDSMTGQDAVNVAESFDDQLDVTGVTLTKLDGDTRGGAALSIRSVTQKPIKFVGMSEKLDGLELFHPERMASRILGMGDVLSLIEKAQQDVDQEKAKDLEKKMRESSFTLDDFLEQLDQVKNLGPLDDIMKMIPGMNKMKGLDKLNMSEKQIDHIKAIIQSMTPAERNNPDTLNVSRKKRIAKGSGRSLQEVNRLMKQFNDMKKMMKQFTGGGKGKKGKRNQMQNMLKGMNLPF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06470 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63

Relevant publications[edit source | edit]