From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS07760 [old locus tag: NWMN_1378 ]
  • pan locus tag?: SAUPAN003929000
  • symbol: NWMN_RS07760
  • pan gene symbol?: ndk
  • synonym:
  • product: nucleoside-diphosphate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS07760 [old locus tag: NWMN_1378 ]
  • symbol: NWMN_RS07760
  • product: nucleoside-diphosphate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 1545215..1545664
  • length: 450
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1545215..1545664) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    GTGGAACGTACATTTTTAATGATTAAACCAGATGCAGTACAAAGAAATCTAATTGGTGAA
    GTAATTTCAAGAATTGAAAGAAAAGGACTAAAACTTGTCGGTGGTAAATTAATGCAAGTA
    CCAATGGAACTTGCTGAAACACATTATGGTGAACACCAAGGTAAACCATTTTATAATGAT
    TTAATTTCATTTATTACATCAGCACCAGTGTTCGCAATGGTAGTTGAAGGTGAAGATGCA
    GTTAATGTATCTAGACATATTATTGGCAGCACCAATCCTTCAGAAGCTTCACCAGGATCA
    ATTAGAGGTGATTTAGGTTTAACTGTTGGTAGAAATATCATTCACGGTTCAGATTCATTA
    GAGTCTGCTGAACGTGAAATTAATCTATGGTTTAATGAAAATGAAATTACTAGCTATGCT
    TCACCACGTGATGCATGGTTATATGAATAA
    60
    120
    180
    240
    300
    360
    420
    450

Protein[edit source | edit]

Protein Data Bank: 3Q83
Protein Data Bank: 3Q86
Protein Data Bank: 3Q89
Protein Data Bank: 3Q8U
Protein Data Bank: 3Q8V
Protein Data Bank: 3Q8Y

General[edit source | edit]

  • locus tag: NWMN_RS07760 [old locus tag: NWMN_1378 ]
  • symbol: NWMN_RS07760
  • description: nucleoside-diphosphate kinase
  • length: 149
  • theoretical pI: 4.82307
  • theoretical MW: 16574.6
  • GRAVY: -0.248322

Function[edit source | edit]

  • reaction:
    EC 2.7.4.6?  ExPASy
    Nucleoside-diphosphate kinaseATP + nucleoside diphosphate = ADP + nucleoside triphosphate
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan definedNDK; Nucleoside diphosphate kinase (PF00334; HMM-score: 192.2)
    TIM_barrel (CL0036) OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.154
    • Ymax_pos: 46
    • Cmax: 0.154
    • Cmax_pos: 46
    • Smax: 0.277
    • Smax_pos: 44
    • Smean: 0.111
    • D: 0.137
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446364625 NCBI
  • RefSeq: WP_000442480 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MERTFLMIKPDAVQRNLIGEVISRIERKGLKLVGGKLMQVPMELAETHYGEHQGKPFYNDLISFITSAPVFAMVVEGEDAVNVSRHIIGSTNPSEASPGSIRGDLGLTVGRNIIHGSDSLESAEREINLWFNENEITSYASPRDAWLYE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS07760 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]