From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS08365 [old locus tag: NWMN_1486 ]
  • pan locus tag?: SAUPAN004166000
  • symbol: NWMN_RS08365
  • pan gene symbol?: hemN
  • synonym:
  • product: coproporphyrinogen III oxidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS08365 [old locus tag: NWMN_1486 ]
  • symbol: NWMN_RS08365
  • product: coproporphyrinogen III oxidase
  • replicon: chromosome
  • strand: -
  • coordinates: 1653049..1654173
  • length: 1125
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1653049..1654173) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGACGGTACAAAGTGCATATATACATATTCCATTTTGTGTAAGAATATGTACATATTGT
    GATTTCAATAAATATTTTATACAGAATCAACCTGTAGATGAGTACTTAGATGCACTAATC
    ACAGAAATGTCTACAGCAAAATATAGGATCTTAAAGACCATGTATGTAGGTGGCGGCACA
    CCAACGGCCCTTTCTATTAATCAGTTGGAAAGATTACTTAAAGCAATACGTGATACGTTT
    ACAATCACAGGCGAGTATACATTTGAAGCAAATCCTGATGAGTTAACTAAAGAGAAAGTC
    CAACTATTAGAGAAATATGGAGTAAAAAGGATTTCAATGGGCGTTCAAACATTCAAGCCG
    GAGTTATTGTCTGTTTTAGGTAGAACGCACAATACTGAAGATATTTACACTTCGGTGTTA
    AATGCTAAAAACGCAGGTATTAAATCAATCAGTTTAGATTTAATGTATCATTTACCGAAA
    CAGACGATTGAAGATTTTGAACAAAGTTTAGATCTAGCTTTAGATATGGATATTCAACAT
    ATTTCGAGTTACGGCTTAATACTTGAACCTAAAACCCAATTTTATAATATGTATAGAAAA
    GGCTTGCTCAAACTTCCTAATGAGGATTTAGGTGCTGACATGTATCAGTTGCTGATGTCT
    AAGATAGAACAATCTCCTTTCCATCAATACGAAATATCTAATTTTGCATTAGATGGCCAT
    GAATCAGAACATAATAAGGTTTACTGGTTTAATGAGGAATATTATGGATTTGGAGCAGGT
    GCAAGTGGTTATGTAGATGGTGTGCGTTATACGAATATCAATCCAGTGAATCATTATATC
    AAAGCTATAAATAAAGAAAGTAAAGCAATTTTAGTATCAAATAAACCTTCTTTGACTGAG
    AGAATGGAAGAAGAAATGTTTCTTGGGTTGCGTTTAAATGAAGGTGTGAGTAGTAGTAGG
    TTCAAAAAGAAGTTTGACCAATCTATTGAAAGTGTCTTTGGTCAAACAATAAATAATTTA
    AAAGAGAAGGAATTAATTGTAGAAAAGAACGATGTGATTGCACTTACAAATAGAGGGAAA
    GTCATAGGTAATGAGGTTTTTGAAGCTTTCCTAATAAATGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS08365 [old locus tag: NWMN_1486 ]
  • symbol: NWMN_RS08365
  • description: coproporphyrinogen III oxidase
  • length: 374
  • theoretical pI: 5.31963
  • theoretical MW: 42866.6
  • GRAVY: -0.324064

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminputative oxygen-independent coproporphyrinogen III oxidase (TIGR00539; EC 1.3.99.22; HMM-score: 375.2)
    putative heme utilization radical SAM enzyme HutW (TIGR04107; HMM-score: 206.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamincoproporphyrinogen dehydrogenase HemZ (TIGR03994; EC 1.3.99.22; HMM-score: 160.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminoxygen-independent coproporphyrinogen III oxidase (TIGR00538; EC 1.3.99.22; HMM-score: 149.8)
    HemN-related non-iron pseudo-SAM protein PsgB (TIGR04419; HMM-score: 83.8)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_1487 family (TIGR04013; HMM-score: 48.1)
    Unknown functionEnzymes of unknown specificityradical SAM protein, TIGR01212 family (TIGR01212; HMM-score: 45.6)
    Genetic information processingTranscriptionDNA-dependent RNA polymeraseradical SAM enzyme/protein acetyltransferase, ELP3 family (TIGR01211; EC 2.3.1.48; HMM-score: 39.6)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA-i(6)A37 thiotransferase enzyme MiaB (TIGR01574; EC 2.-.-.-; HMM-score: 25.6)
    Unknown functionEnzymes of unknown specificityB12-binding domain/radical SAM domain protein, MJ_0865 family (TIGR04014; HMM-score: 23.3)
    radical SAM methylthiotransferase, MiaB/RimO family (TIGR00089; EC 2.1.1.-,2.8.1.-; HMM-score: 21.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 21.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme (TIGR01579; HMM-score: 18)
    putative metalloenzyme radical SAM/SPASM domain maturase (TIGR04311; HMM-score: 17.7)
    Cellular processesCellular processesToxin production and resistanceribosomal peptide maturation radical SAM protein 1 (TIGR03975; HMM-score: 17.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis protein ThiH (TIGR02351; HMM-score: 14.6)
    hopanoid biosynthesis associated radical SAM protein HpnJ (TIGR03471; HMM-score: 14.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinprobable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 14.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneputative menaquinone biosynthesis radical SAM enzyme, SCO4494 family (TIGR03700; HMM-score: 13.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercoenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 12.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinonedehypoxanthine futalosine cyclase (TIGR03699; HMM-score: 11.4)
    pseudo-rSAM protein/SPASM domain protein (TIGR04347; HMM-score: 11.3)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 73.1)
    HTH (CL0123) HemN_C; HemN C-terminal domain (PF06969; HMM-score: 52)
    4Fe-4S (CL0344) Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 11
    • Cmax: 0.108
    • Cmax_pos: 21
    • Smax: 0.233
    • Smax_pos: 2
    • Smean: 0.154
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446140235 NCBI
  • RefSeq: WP_000218090 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTVQSAYIHIPFCVRICTYCDFNKYFIQNQPVDEYLDALITEMSTAKYRILKTMYVGGGTPTALSINQLERLLKAIRDTFTITGEYTFEANPDELTKEKVQLLEKYGVKRISMGVQTFKPELLSVLGRTHNTEDIYTSVLNAKNAGIKSISLDLMYHLPKQTIEDFEQSLDLALDMDIQHISSYGLILEPKTQFYNMYRKGLLKLPNEDLGADMYQLLMSKIEQSPFHQYEISNFALDGHESEHNKVYWFNEEYYGFGAGASGYVDGVRYTNINPVNHYIKAINKESKAILVSNKPSLTERMEEEMFLGLRLNEGVSSSRFKKKFDQSIESVFGQTINNLKEKELIVEKNDVIALTNRGKVIGNEVFEAFLIND

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS08365 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]