From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
  • pan locus tag?: SAUPAN005301000
  • symbol: NWMN_RS11300
  • pan gene symbol?:
  • synonym:
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
  • symbol: NWMN_RS11300
  • product: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • replicon: chromosome
  • strand: -
  • coordinates: 2168480..2168914
  • length: 435
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2168480..2168914) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAATCAATTTGCTATATTTTTAGTTGAGCAATTGAAAAGTGGTGATTTGATTTTACTT
    AACGGAGATTTAGGAGCAGGTAAAACAACGTTAACGCAATTTATAGGAAAAGCTCTTGGT
    GTAAGACGTACGATTAATTCCCCGACATTTAACATCATTAAATCATATAGGGGTAAAAAT
    TTAAAATTGCATCATATGGATTGTTATCGCTTAGAAGATTCTGATGAAGATTTAGGATTT
    GATGAATTTTTCGAAGATCAGGCAATTACTGTTATTGAATGGAGTCAATTTATAAAAGAT
    TTACTTCCAGCGACGCATTTATCTATTAACATTTCAACAATATCTGAAAATACAAGACAA
    ATTGAGTTGTTCGCGCAAGGAGAACATTATGAACAAATTAAGGAGGCAATTATCCATGAA
    TTCGCTGCTCATTGA
    60
    120
    180
    240
    300
    360
    420
    435

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS11300 [old locus tag: NWMN_1959 ]
  • symbol: NWMN_RS11300
  • description: tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
  • length: 144
  • theoretical pI: 4.97011
  • theoretical MW: 16441.5
  • GRAVY: -0.189583

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 125.6)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 15.4)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 14.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 12.7)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 12.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 12.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 12)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 10.7)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 119.5)
    AAA_18; AAA domain (PF13238; HMM-score: 21.9)
    NACHT; NACHT domain (PF05729; HMM-score: 16.5)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14.9)
    AAA_23; AAA domain (PF13476; HMM-score: 14.9)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 14.8)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.4)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 13)
    AAA_33; AAA domain (PF13671; HMM-score: 12.7)
    AAA_22; AAA domain (PF13401; HMM-score: 12.7)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12.5)
    TIM_barrel (CL0036) DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 12.2)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.13
    • Ymax_pos: 26
    • Cmax: 0.115
    • Cmax_pos: 26
    • Smax: 0.216
    • Smax_pos: 14
    • Smean: 0.152
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI:
  • RefSeq: WP_010956572 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNQFAIFLVEQLKSGDLILLNGDLGAGKTTLTQFIGKALGVRRTINSPTFNIIKSYRGKNLKLHHMDCYRLEDSDEDLGFDEFFEDQAITVIEWSQFIKDLLPATHLSINISTISENTRQIELFAQGEHYEQIKEAIIHEFAAH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS11300 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]