From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS11625 [old locus tag: NWMN_2010 ]
  • pan locus tag?: SAUPAN005397000
  • symbol: NWMN_RS11625
  • pan gene symbol?: atpH
  • synonym:
  • product: ATP synthase subunit delta

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS11625 [old locus tag: NWMN_2010 ]
  • symbol: NWMN_RS11625
  • product: ATP synthase subunit delta
  • replicon: chromosome
  • strand: -
  • coordinates: 2229383..2229922
  • length: 540
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2229383..2229922) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGGTAAAAGTAGCTAACAAGTATGCTAAAGCATTATTTGACGTGTCATTAGATACAAAT
    AATTTAGAGACTATTAATGAAGAATTAACAGTTATAAATGAAGCAGTAAAAGATAAAATT
    GAGCAATTGAGAATGGTTGACAGTAATCCAACTCAAACAGCAGAACAACGTCGTGAGTTG
    ATTAATGGTGTATTTACTGACATTAATCCATACATTAAAAATATGATGTACGTGTTAGCA
    GATAATAGACATATCTCATTAATAGCTGACGTATTCAAGGCGTTCCAAAGCTTATATAAC
    GGACACTACAATCAAGATTTTGCAACAATTGAGTCAACATATGAATTGAGTCAAGAAGAG
    TTAGATAAGATTGTCAAACTAGTAACTCAACAAACGAAGTTATCTAAAGTTATTGTAGAT
    ACAAAAATTAATCCAGATTTAATTGGTGGATTTAGAGTTAAAGTCGGCACAACTGTATTA
    GATGGTAGTGTTAGAAATGATCTTGTCCAATTACAAAGAAAATTTAGAAGAGTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS11625 [old locus tag: NWMN_2010 ]
  • symbol: NWMN_RS11625
  • description: ATP synthase subunit delta
  • length: 179
  • theoretical pI: 6.55013
  • theoretical MW: 20498.3
  • GRAVY: -0.319553

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismATP-proton motive force interconversionATP synthase F1, delta subunit (TIGR01145; EC 3.6.3.14; HMM-score: 118.5)
    alternate F1F0 ATPase, F0 subunit B (TIGR03321; EC 3.6.3.-; HMM-score: 23.9)
  • TheSEED:
  • PFAM:
    ATP_synthase (CL0255) OSCP; ATP synthase delta (OSCP) subunit (PF00213; HMM-score: 147.9)
    GT-A (CL0110) Glyco_transf_15; Glycolipid 2-alpha-mannosyltransferase (PF01793; HMM-score: 19.6)
    PH (CL0266) SPT16; FACT complex subunit (SPT16/CDC68) (PF08644; HMM-score: 16)
    no clan definedKxDL; Uncharacterized conserved protein (PF10241; HMM-score: 14.2)
    Tubulin_C (CL0442) FtsZ_C; FtsZ family, C-terminal domain (PF12327; HMM-score: 12.7)
    HTH (CL0123) Sigma54_CBD; Sigma-54 factor, core binding domain (PF04963; HMM-score: 12.6)
    no clan definedFrankia_peptide; Ribosomally synthesized peptide prototyped by Frankia Franean1_4349. (PF14407; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.169
    • Ymax_pos: 12
    • Cmax: 0.11
    • Cmax_pos: 28
    • Smax: 0.346
    • Smax_pos: 1
    • Smean: 0.27
    • D: 0.208
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446163496 NCBI
  • RefSeq: WP_000241351 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVKVANKYAKALFDVSLDTNNLETINEELTVINEAVKDKIEQLRMVDSNPTQTAEQRRELINGVFTDINPYIKNMMYVLADNRHISLIADVFKAFQSLYNGHYNQDFATIESTYELSQEELDKIVKLVTQQTKLSKVIVDTKINPDLIGGFRVKVGTTVLDGSVRNDLVQLQRKFRRVN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS11625 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]