From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS11825 [old locus tag: NWMN_2048 ]
  • pan locus tag?: SAUPAN005442000
  • symbol: NWMN_RS11825
  • pan gene symbol?:
  • synonym:
  • product: NAD(P)-dependent oxidoreductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS11825 [old locus tag: NWMN_2048 ]
  • symbol: NWMN_RS11825
  • product: NAD(P)-dependent oxidoreductase
  • replicon: chromosome
  • strand: -
  • coordinates: 2265848..2266513
  • length: 666
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2265848..2266513) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATATTTTGGTTATAGGTGCTAATGGCGGTGTAGGTTCGTTACTAGTGCAACAATTA
    GCAAAAGAAAATGTACCATTTACTGCTGGTGTTAGGCAATCAGATCAACTTAATGCGTTA
    AAATCACAAGGTATGAAAGCAATTCTTGTTGATGTTGAAAATGATTCAATAGAGACTTTA
    ACTGAGACGTTTAAACCATTCGATAAAGTTATCTTTTCAGTAGGTTCTGGAGGGAACACG
    GGTGCAGATAAAACAATTATTGTCGATTTAGATGGTGCTGTTAAATCAATGATTGCGAGT
    AAAGAGGCCAATATTAAACACTATGTCATGGTTTCAACATATGATTCGAGACGTCAGGCT
    TTTGATGATAGCGGTGATTTAAAGCCATATACAATAGCTAAACATTACGCTGATGACTAT
    TTAAGACGTTCAGGTTTGAATTATACAATTTTACATCCAGGGGCACTTACAAATGCAGCA
    GGATCTGGAAAGATAGAAGCTGCACAATATTTTGATGGTAAAGGTGAAATTCCTAGAGAA
    GATGTTGCGACAGTATTAAAAGAAATTGTCACATCCAATCATTTTAATCACCAAGAGTTT
    CAAATTATTAGTGGTGATCAGGACATTAAAGATGCTTTAACTCAATTTGAAAATGAAACG
    GATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    666

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS11825 [old locus tag: NWMN_2048 ]
  • symbol: NWMN_RS11825
  • description: NAD(P)-dependent oxidoreductase
  • length: 221
  • theoretical pI: 4.70039
  • theoretical MW: 24031.7
  • GRAVY: -0.29638

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Unknown functionEnzymes of unknown specificityputative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 21.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 18.9)
    thioester reductase domain (TIGR01746; HMM-score: 16.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesADP-glyceromanno-heptose 6-epimerase (TIGR02197; EC 5.1.3.20; HMM-score: 14.8)
    MetabolismAmino acid biosynthesisAspartate familyaspartate-semialdehyde dehydrogenase (TIGR01296; EC 1.2.1.11; HMM-score: 14.7)
    MetabolismEnergy metabolismFermentationzinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 13.1)
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 12.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, substrate binding protein, PQQ-dependent alcohol dehydrogenase system (TIGR03863; HMM-score: 12.3)
    ergot alkaloid biosynthesis protein, AFUA_2G17970 family (TIGR03649; HMM-score: 12.2)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesdTDP-4-dehydrorhamnose reductase (TIGR01214; EC 1.1.1.133; HMM-score: 11.9)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 10.7)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) NAD_binding_10; NAD(P)H-binding (PF13460; HMM-score: 138.7)
    NmrA; NmrA-like family (PF05368; HMM-score: 44.6)
    Epimerase; NAD dependent epimerase/dehydratase family (PF01370; HMM-score: 36.6)
    3Beta_HSD; 3-beta hydroxysteroid dehydrogenase/isomerase family (PF01073; HMM-score: 20.8)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 19.2)
    RmlD_sub_bind; RmlD substrate binding domain (PF04321; HMM-score: 18.8)
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 16.1)
    DapB_N; Dihydrodipicolinate reductase, N-terminus (PF01113; HMM-score: 14.5)
    Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 13.7)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 13)
    NAD_binding_4; Male sterility protein (PF07993; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.275
    • Ymax_pos: 22
    • Cmax: 0.202
    • Cmax_pos: 22
    • Smax: 0.611
    • Smax_pos: 19
    • Smean: 0.303
    • D: 0.286
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446946838 NCBI
  • RefSeq: WP_001024094 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNILVIGANGGVGSLLVQQLAKENVPFTAGVRQSDQLNALKSQGMKAILVDVENDSIETLTETFKPFDKVIFSVGSGGNTGADKTIIVDLDGAVKSMIASKEANIKHYVMVSTYDSRRQAFDDSGDLKPYTIAKHYADDYLRRSGLNYTILHPGALTNAAGSGKIEAAQYFDGKGEIPREDVATVLKEIVTSNHFNHQEFQIISGDQDIKDALTQFENETD

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS11825 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]