From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS13775 [old locus tag: NWMN_2392 ]
  • pan locus tag?: SAUPAN006108000
  • symbol: NWMN_RS13775
  • pan gene symbol?: sasG
  • synonym:
  • product: accumulation-associated protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS13775 [old locus tag: NWMN_2392 ]
  • symbol: NWMN_RS13775
  • product: accumulation-associated protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2627840..2632339
  • length: 4500
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (2627840..2632339) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    3781
    3841
    3901
    3961
    4021
    4081
    4141
    4201
    4261
    4321
    4381
    4441
    ATGAGAGATAAGAAAGGACCGGTAAATAAAAGAGTAGATTTTCTATCAAATAAATTGAAT
    AAATATTCAATAAGAAAATTTACAGTTGGAACAGCATCTATTTTAATTGGCTCACTAATG
    TATTTGGGAACTCAACAAGAGGCAGAAGCAGCTGAAAACAATATTGAGAATCCAACTACA
    TTAAAAGATAATGTCCAATCAAAAGAAGTGAAGATTGAAGAAGTAACAAACAAAGACACT
    GCACCACAGGGTGTAGAAGCTAAATCTGAAGTAACTTCAAACAAAGACACAATCGAACAT
    GAACCATCAGTAAAAGCTGAAGATATATCAAAAAAGGAGGATACACCAAAAGAAGTAGCT
    GATGTTGCTGAAGTTCAGCCGAAATCGTCAGTCACTCATAACGCAGAGACACCTAAGGTT
    AGAAAAGCTCGTTCTGTTGATGAAGGCTCTTTTGATATTACAAGAGATTCTAAAAATGTA
    GTTGAATCTACCCCAATTACAATTCAAGGTAAAGAACATTTTGAAGGTTACGGAAGTGTT
    GATATACAAAAAAAACCAACAGATTTAGGGGTATCAGAGGTAACCAGGTTTAATGTTGGT
    AATGAAAGTAATGGTTTGATAGGAGCTTTACAATTAAAAAATAAAATAGATTTTAGTAAG
    GATTTCAATTTTAAAGTTAGAGTGGCAAATAACCATCAATCAAATACCACAGGTGCTGAT
    GGTTGGGGGTTCTTATTTAGTAAAGGAAATGCAGAAGAATATTTAACTAATGGTGGAATC
    CTTGGGGATAAAGGTCTGGTAAATTCAGGCGGATTTAAAATTGATACTGGATACATTTAT
    ACAAGTTCCATGGACAAAACTGAAAAGCAAGCTGGACAAGGTTATAGAGGATACGGAGCT
    TTTGTGAAAAATGACAGTTCTGGTAATTCACAAATGGTTGGAGAAAATATTGATAAATCA
    AAAACTAATTTTTTAAACTATGCGGACAATTCAACTAATACATCAGATGGAAAGTTTCAT
    GGGCAACGTTTAAATGATGTCATCTTAACTTATGTTGCTTCAACTGGTAAAATGAGAGCA
    GAATATGCTGGTAAAACTTGGGAGACTTCAATAACAGATTTAGGTTTATCTAAAAATCAG
    GCATATAATTTCTTAATTACATCTAGTCAAAGATGGGGCCTTAATCAAGGGATAAATGCA
    AATGGCTGGATGAGAACTGACTTGAAAGGTTCAGAGTTTACTTTTACACCAGAAGCGCCA
    AAAACAATAACAGAATTAGAAAAAAAAGTTGAAGAGATTCCATTCAAGAAAGAACGTAAA
    TTTAATCCGGATTTAGCACCAGGGACAGAAAAAGTAACAAGAGAAGGACAAAAAGGTGAG
    AAGACAATAACGACACCAACACTAAAAAATCCATTAACTGGAGTAATTATTAGTAAAGGT
    GAACCAAAAGAAGAGATTACAAAAGATCCGATTAATGAATTAACAGAATACGGACCTGAA
    ACAATAGCGCCAGGTCATCGAGACGAATTTGATCCGAAGTTACCAACAGGAAAGAAAGAG
    GAAGTTCCAGGTAAACCAGGAATTAAGAATCCAGAAACAGGAGACGTAGTTAGACCGCCG
    GTCGATAGCGTAACAAAATATGGACCTGTAAAAGGAGACTCGATTGTAGAAAAAGAAGAG
    ATTCCATTCGAGAAAGAACGTAAATTTAATCCGGATTTAGCACCAGGGACAGAAAAAGTA
    ACAAGAGAAGGACAAAAAGGTGAGAAGACAATAACGACGCCAACACTAAAAAATCCATTA
    ACTGGAGAAATTATTAGTAAAGGTGAATCGAAAGAAGAAATCACAAAAGATCCGATTAAT
    GAATTAACAGAATACGGACCAGAAACGATAACACCAGGTCATCGAGACGAATTTGATCCG
    AAGTTACCAACAGGAGAGAAAGAGGAAGTTCCAGGTAAACCAGGAATTAAGAATCCAGAA
    ACAGGAGATGTAGTTAGACCACCGGTCGATAGCGTAACAAAATATGGACCTGTAAAAGGA
    GACTCGATTGTAGAAAAAGAAGAGATTCCATTCGAGAAAGAACGTAAATTTAATCCGGAT
    TTAGCACCAGGGACAGAAAAAGTAACAAGAGAAGGACAAAAAGGTGAGAAGACAATAACG
    ACACCAACACTAAAAAATCCATTAACTGGAGTAATTATTAGTAAAGGTGAACCAAAAGAA
    GAAATCACAAAAGATCCGATTAATGAATTAACAGAATACGGACCAGAAACGATAACACCA
    GGTCATCGAGACGAATTTGATCCGAAGTTACCAACAGGAGAGAAAGAAGAAGTTCCAGGT
    AAACCAGGAATTAAGAATCCAGAAACAGGAGACGTAGTTAGACCACCGGTCGATAGCGTA
    ACAAAATATGGACCTGTAAAAGGAGACTCGATTGTAGAAAAAGAAGAAATTCCATTCAAG
    AAAGAACGTAAATTTAATCCTGATTTAGCACCAGGGACAGAAAAAGTAACAAGAGAAGGA
    CAAAAAGGTGAGAAGACAATAACGACGCCAACACTAAAAAATCCATTAACTGGAGAAATT
    ATTAGTAAAGGTGAATCGAAAGAAGAAATCACAAAAGATCCGATTAATGAATTAACAGAA
    TACGGACCAGAAACGATAACACCAGGTCATCGAGACGAATTTGATCCGAAGTTACCAACA
    GGAGAGAAAGAGGAAGTTCCAGGTAAACCAGGAATTAAGAATCCAGAAACAGGAGACGTA
    GTTAGACCACCGGTCGATAGCGTAACAAAATATGGACCTGTAAAAGGAGACTCGATTGTA
    GAAAAAGAAGAAATTCCATTCAAGAAAGAACGTAAATTTAATCCTGATTTAGCACCAGGG
    ACAGAAAAAGTAACAAGAGAAGGACAAAAAGGTGAGAAGACAATAACGACGCCAACACTA
    AAAAATCCATTAACTGGAGAAATTATTAGTAAAGGTGAATCGAAAGAAGAAATCACAAAA
    GATCCGATTAATGAATTAACAGAATACGGACCAGAAACGATAACACCAGGTCATCGAGAC
    GAATTTGATCCGAAGTTACCAACAGGAGAGAAAGAGGAAGTTCCAGGTAAACCAGGAATT
    AAGAATCCAGAAACAGGAGATGTAGTTAGACCACCGGTCGATAGCGTAACAAAATATGGA
    CCTGTAAAAGGAGACTCGATTGTAGAAAAAGAAGAAATTCCATTCGAGAAAGAACGTAAA
    TTTAATCCTGATTTAGCACCAGGGACAGAAAAAGTAACAAGAGAAGGACAAAAAGGTGAG
    AAGACAATAACGACGCCAACACTAAAAAATCCATTAACTGGAGAAATTATTAGTAAAGGT
    GAATCGAAAGAAGAAATCACAAAAGATCCGATTAATGAATTAACAGAATACGGACCAGAA
    ACGATAACACCAGGTCATCGAGACGAATTTGATCCGAAGTTACCAACAGGAGAGAAAGAG
    GAAGTTCCAGGTAAACCAGGAATTAAGAATCCAGAAACAGGAGATGTAGTTAGACCACCG
    GTCGATAGCGTAACAAAATATGGACCTGTAAAAGGAGACTCGATTGTAGAAAAAGAAGAA
    ATTCCATTCGAGAAAGAACGTAAATTTAATCCTGATTTAGCACCAGGGACAGAAAAAGTA
    ACAAGAGAAGGACAAAAAGGTGAGAAGACAATAACGACGCCAACACTAAAAAATCCATTA
    ACTGGAGAAATTATTAGTAAAGGTGAATCGAAAGAAGAAATCACAAAAGATCCAGTTAAT
    GAATTAACAGAATTCGGTGGCGAGAAAATACCGCAAGGTCATAAAGATATCTTTGATCCA
    AACTTACCAACAGATCAAACGGAAAAAGTACCAGGTAAACCAGGAATCAAGAATCCAGAC
    ACAGGAAAAGTGATCGAAGAGCCAGTGGATGATGTGATTAAACACGGACCAAAAACGGGT
    ACACCAGAAACAAAAACAGTAGAGATACCGTTTGAAACAAAACGTGAGTTTAATCCAAAA
    TTACAACCTGGTGAAGAGCGAGTGAAACAAGAAGGACAACCAGGAAGTAAGACAATCACA
    ACACCAATCACAGTGAACCCATTAACAGGTGAAAAAGTTGGCGAGGGTCAACCAACAGAA
    GAGATCACAAAACAACCAGTAGATAAGATTGTAGAGTTCGGTGGAGAGAAACCAAAAGAT
    CCAAAAGGACCTGAAAACCCAGAGAAGCCGAGCAGACCAACTCATCCAAGTGGCCCAGTA
    AATCCTAACAATCCAGGATTATCGAAAGACAGAGCAAAACCAAATGGCCCAGTTCATTCA
    ATGGATAAAAATGATAAAGTTAAAAAATCTAAAATTGCTAAAGAATCAGTAGCTAATCAA
    GAGAAAAAACGAGCAGAATTACCAAAAACAGGTTTAGAAAGCACGCAAAAAGGTTTGATC
    TTTAGTAGTATAATTGGAATTGCTGGATTAATGTTATTGGCTCGTAGAAGAAAGAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3780
    3840
    3900
    3960
    4020
    4080
    4140
    4200
    4260
    4320
    4380
    4440
    4500

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS13775 [old locus tag: NWMN_2392 ]
  • symbol: NWMN_RS13775
  • description: accumulation-associated protein
  • length: 1499
  • theoretical pI: 5.21479
  • theoretical MW: 164464
  • GRAVY: -0.978652

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    calcium-translocating P-type ATPase, PMCA-type (TIGR01517; EC 3.6.3.8; HMM-score: 57.9)
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 46.1)
    Cell structureCell envelopeOtherLPXTG cell wall anchor domain (TIGR01167; HMM-score: 23.6)
    zinc metalloproteinase 18-residue repeat (TIGR04227; HMM-score: 9.1)
  • TheSEED:
  • PFAM:
    G5 (CL0593) SasG_E; E domain (PF17041; HMM-score: 640.6)
    G5; G5 domain (PF07501; HMM-score: 316.2)
    no clan definedYSIRK_signal; YSIRK type signal peptide (PF04650; HMM-score: 44.2)
    DMP12; DNA-mimic protein (PF16779; HMM-score: 31.8)
    NTF2 (CL0051) DUF3828; Protein of unknown function (DUF3828) (PF12883; HMM-score: 25.1)
    no clan definedGram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 24.9)
    2C_adapt; 2-cysteine adaptor domain (PF08793; HMM-score: 19.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 10
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide length 51 aa
    • Ymax: 0.626
    • Ymax_pos: 51
    • Cmax: 0.66
    • Cmax_pos: 51
    • Smax: 0.722
    • Smax_pos: 47
    • Smean: 0.345
    • D: 0.517
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447127839 NCBI
  • RefSeq: WP_001205095 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRDKKGPVNKRVDFLSNKLNKYSIRKFTVGTASILIGSLMYLGTQQEAEAAENNIENPTTLKDNVQSKEVKIEEVTNKDTAPQGVEAKSEVTSNKDTIEHEPSVKAEDISKKEDTPKEVADVAEVQPKSSVTHNAETPKVRKARSVDEGSFDITRDSKNVVESTPITIQGKEHFEGYGSVDIQKKPTDLGVSEVTRFNVGNESNGLIGALQLKNKIDFSKDFNFKVRVANNHQSNTTGADGWGFLFSKGNAEEYLTNGGILGDKGLVNSGGFKIDTGYIYTSSMDKTEKQAGQGYRGYGAFVKNDSSGNSQMVGENIDKSKTNFLNYADNSTNTSDGKFHGQRLNDVILTYVASTGKMRAEYAGKTWETSITDLGLSKNQAYNFLITSSQRWGLNQGINANGWMRTDLKGSEFTFTPEAPKTITELEKKVEEIPFKKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGVIISKGEPKEEITKDPINELTEYGPETIAPGHRDEFDPKLPTGKKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFEKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGEIISKGESKEEITKDPINELTEYGPETITPGHRDEFDPKLPTGEKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFEKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGVIISKGEPKEEITKDPINELTEYGPETITPGHRDEFDPKLPTGEKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFKKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGEIISKGESKEEITKDPINELTEYGPETITPGHRDEFDPKLPTGEKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFKKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGEIISKGESKEEITKDPINELTEYGPETITPGHRDEFDPKLPTGEKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFEKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGEIISKGESKEEITKDPINELTEYGPETITPGHRDEFDPKLPTGEKEEVPGKPGIKNPETGDVVRPPVDSVTKYGPVKGDSIVEKEEIPFEKERKFNPDLAPGTEKVTREGQKGEKTITTPTLKNPLTGEIISKGESKEEITKDPVNELTEFGGEKIPQGHKDIFDPNLPTDQTEKVPGKPGIKNPDTGKVIEEPVDDVIKHGPKTGTPETKTVEIPFETKREFNPKLQPGEERVKQEGQPGSKTITTPITVNPLTGEKVGEGQPTEEITKQPVDKIVEFGGEKPKDPKGPENPEKPSRPTHPSGPVNPNNPGLSKDRAKPNGPVHSMDKNDKVKKSKIAKESVANQEKKRAELPKTGLESTQKGLIFSSIIGIAGLMLLARRRKN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS13775 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]