From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0232 [new locus tag: SA_RS01365 ]
  • pan locus tag?: SAUPAN001107000
  • symbol: lctE
  • pan gene symbol?: ldh1
  • synonym:
  • product: L-lactate dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0232 [new locus tag: SA_RS01365 ]
  • symbol: lctE
  • product: L-lactate dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 281331..282284
  • length: 954
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAACAAATTTAAAGGGAACAAAGTTGTATTAATAGGTAATGGTGCAGTAGGTTCAAGC
    TACGCATTTTCATTAGTGAACCAAAGCATTGTTGATGAATTAGTCATCATTGATTTAGAC
    ACTGAAAAAGTTCGAGGAGATGTTATGGATTTAAAACATGCCACACCATATTCTCCAACA
    ACAGTTCGTGTGAAAGCTGGCGAATACAGTGATTGTCATGATGCGGATCTAGTTGTCATC
    TGTGCTGGTGCTGCACAAAAACCTGGAGAAACACGTTTAGATTTAGTATCTAAAAACTTG
    AAAATATTCAAATCAATTGTTGGTGAAGTAATGGCATCAAAATTTGATGGTATTTTCTTG
    GTAGCTACAAATCCTGTTGATATTTTAGCGTATGCAACATGGAAATTCTCTGGTTTACCT
    AAAGAACGTGTTATAGGTTCTGGTACAATTTTAGACTCTGCACGCTTTAGATTATTGTTA
    AGCGAAGCGTTCGATGTTGCGCCACGTAGCGTCGATGCTCAAATTATTGGTGAACATGGT
    GACACTGAATTACCAGTATGGTCACACGCTAATATTGCGGGTCAACCTTTGAAGACATTA
    CTTGAACAACGTCCTGAGGGCAAAGCGCAAATTGAACAAATTTTTGTTCAAACACGTGAT
    GCAGCATATGACATTATTCAAGCTAAAGGTGCCACTTATTATGGTGTTGCAATGGGATTA
    GCTAGAATTACTGAAGCGATTTTCAGAAATGAAGATGCCGTATTGACTGTATCAGCATTA
    TTAGAAGGCGAATATGATGAAGAAGATGTTTATATTGGTGTTCCAGCAGTCATCAATAGA
    AACGGTATTCGCAACGTCGTAGAAATCCCATTAAACGACGAAGAACAAAGCAAGTTCGCA
    CATTCAGCTAAAACATTAAAAGATATTATGGCTGAAGCAGAAGAACTTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    954

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0232 [new locus tag: SA_RS01365 ]
  • symbol: LctE
  • description: L-lactate dehydrogenase
  • length: 317
  • theoretical pI: 4.68843
  • theoretical MW: 34569.2
  • GRAVY: -0.0312303

Function[edit source | edit]

  • reaction:
    EC 1.1.1.27?  ExPASy
    L-lactate dehydrogenase(S)-lactate + NAD+ = pyruvate + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismAnaerobicL-lactate dehydrogenase (TIGR01771; EC 1.1.1.27; HMM-score: 433.2)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisL-lactate dehydrogenase (TIGR01771; EC 1.1.1.27; HMM-score: 433.2)
    MetabolismEnergy metabolismTCA cyclemalate dehydrogenase, NAD-dependent (TIGR01763; EC 1.1.1.37; HMM-score: 240)
    MetabolismEnergy metabolismTCA cyclemalate dehydrogenase, NAD-dependent (TIGR01772; EC 1.1.1.37; HMM-score: 78.7)
    malate dehydrogenase (TIGR01759; EC 1.1.1.-; HMM-score: 68.4)
    malate dehydrogenase, NAD-dependent (TIGR01758; EC 1.1.1.37; HMM-score: 54)
    lactate dehydrogenase (TIGR01756; EC 1.1.1.27; HMM-score: 37.9)
    malate dehydrogenase, NADP-dependent (TIGR01757; EC 1.1.1.82; HMM-score: 21.5)
    Genetic information processingProtein fateProtein modification and repaircoenzyme F420-reducing hydrogenase, FrhD protein (TIGR00130; HMM-score: 14.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis adenylyltransferase ThiF (TIGR02356; EC 2.7.7.73; HMM-score: 13.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 11.8)
  • TheSEED:  
    CarbohydratesFermentationFermentations: Lactate L-lactate dehydrogenase (EC 1.1.1.27) 
    FermentationFermentations: Mixed acid L-lactate dehydrogenase (EC 1.1.1.27) 
  • PFAM:
    NADP_Rossmann (CL0063) Ldh_1_N; lactate/malate dehydrogenase, NAD binding domain (PF00056; HMM-score: 162.4)
    LDH_C (CL0341) Ldh_1_C; lactate/malate dehydrogenase, alpha/beta C-terminal domain (PF02866; HMM-score: 126)
    NADP_Rossmann (CL0063) NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.4)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 13.9)
    Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 13.3)
    ThiF; ThiF family (PF00899; HMM-score: 12.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1533(ackA)acetate kinase  [1] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [1] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA2428(arcA)arginine deiminase  [1] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA2425(arcC)carbamate kinase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA1518(citZ)citrate synthase  [1] (data from MRSA252)
    SA1234(cspA)cold-shock protein CspA  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA2312(ddh)D-lactate dehydrogenase  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0133(dra)deoxyribose-phosphate aldolase  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA0545(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SA0843(fab)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA1927(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA1410(grpE)heat shock protein GrpE  [1] (data from MRSA252)
    SA0376(guaA)GMP synthase  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA0819(gudB)NAD-specific glutamate dehydrogenase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1036(ileS)isoleucyl-tRNA synthetase  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA1170(katA)catalase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SA0730(pgm)phosphoglyceromutase  [1] (data from MRSA252)
    SA1117(pnpA)polynucleotide phosphorylase  [1] (data from MRSA252)
    SA1106(proS)prolyl-tRNA synthetase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA1929(pyrG)CTP synthetase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SA0501(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SA1930(rpoE)DNA-directed RNA polymerase subunit delta  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2034(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [1] (data from MRSA252)
    SA0456(spoVG)regulatory protein SpoVG  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA1177(tkt)transketolase  [1] (data from MRSA252)
    SA1535(tpx)thiol peroxidase  [1] (data from MRSA252)
    SA1653(TRAP)signal transduction protein TRAP  [1] (data from MRSA252)
    SA0992(trxA)thioredoxin  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0295hypothetical protein  [1] (data from MRSA252)
    SA0437hypothetical protein  [1] (data from MRSA252)
    SA0478glutamine amidotransferase subunit PdxT  [1] (data from MRSA252)
    SA0537phosphomethylpyrimidine kinase  [1] (data from MRSA252)
    SA0587hypothetical protein  [1] (data from MRSA252)
    SA0606hypothetical protein  [1] (data from MRSA252)
    SA0618hypothetical protein  [1] (data from MRSA252)
    SA0627hypothetical protein  [1] (data from MRSA252)
    SA0641hypothetical protein  [1] (data from MRSA252)
    SA0707hypothetical protein  [1] (data from MRSA252)
    SA0758hypothetical protein  [1] (data from MRSA252)
    SA0760glycine cleavage system protein H  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA0941hypothetical protein  [1] (data from MRSA252)
    SA0959hypothetical protein  [1] (data from MRSA252)
    SA1255PTS system glucose-specific transporter subunit enzyme II A  [1] (data from MRSA252)
    SA1271threonine dehydratase  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1571D-alanine aminotransferase  [1] (data from MRSA252)
    SA1572dipeptidase PepV  [1] (data from MRSA252)
    SA1599translaldolase  [1] (data from MRSA252)
    SA1709hypothetical protein  [1] (data from MRSA252)
    SA2098glycerate dehydrogenase  [1] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SAS0444-oxalocrotonate tautomerase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.212
    • Ymax_pos: 23
    • Cmax: 0.16
    • Cmax_pos: 32
    • Smax: 0.466
    • Smax_pos: 1
    • Smean: 0.312
    • D: 0.251
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKFKGNKVVLIGNGAVGSSYAFSLVNQSIVDELVIIDLDTEKVRGDVMDLKHATPYSPTTVRVKAGEYSDCHDADLVVICAGAAQKPGETRLDLVSKNLKIFKSIVGEVMASKFDGIFLVATNPVDILAYATWKFSGLPKERVIGSGTILDSARFRLLLSEAFDVAPRSVDAQIIGEHGDTELPVWSHANIAGQPLKTLLEQRPEGKAQIEQIFVQTRDAAYDIIQAKGATYYGVAMGLARITEAIFRNEDAVLTVSALLEGEYDEEDVYIGVPAVINRNGIRNVVEIPLNDEEQSKFAHSAKTLKDIMAEAEELK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • lctE no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1851 (Rex*)
    Rex* (TF) important in Energy metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]