From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0304 [new locus tag: SA_RS01755 ]
  • pan locus tag?: SAUPAN001239000
  • symbol: nanA
  • pan gene symbol?: nanA
  • synonym:
  • product: N-acetylneuraminate lyase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0304 [new locus tag: SA_RS01755 ]
  • symbol: nanA
  • product: N-acetylneuraminate lyase
  • replicon: chromosome
  • strand: -
  • coordinates: 359812..360693
  • length: 882
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAACAAAGATTTAAAAGGTTTATATGCAGCGTTACTCGTTCCTTTTGATGAAAATGGT
    CAAGTAAATGAACAAGGACTTAAACAAATTGCTCAAAATGCCATTGAAACTGAAGAATTA
    GACGGTCTTTATGTAAATGGTAGCTCAGGCGAAAACTTTTTATTAAATACAGAGCAGAAG
    AAGCAAGTTTTCAAGGTTGCCAAAGAGGCAGTTGGGGATAAAGTGAAATTGATTGCTCAA
    GTAGGTTCGTTAGATTTAAATGAAGCCATTGAACTCGGAAAATATGCCACAGAACTCGGT
    TATGATGCACTTTCTGCCGTAACACCATTCTACTATCCATTTACTTTTGAAGAAATTAGA
    GATTACTATTTCGATATTATCGAAGCAACACAGAACAATATGATTATTTATGCAATACCA
    GATTTAACAGGTGTGAATATTTCTATTGAACAATTCAGCGAGCTATTTAATCACGAAAAA
    ATTGTTGGTGTTAAATATACAGCGCCGAACTTCTTCCTACTCGAACGTATTAGAAAAGCA
    TTCCCAGACAAATTAATCTTATCTGGCTTTGATGAAATGTTAGTTCAAGCTACGATTTCT
    GGCGTAGATGGTGCAATTGGTTCTACATATAACGTTAATGGTCGCCGCGCTAGAAAAATC
    TTCGACTTAGCACGACAAGGTCAAATTCAAGAAGCTTACCAACTACAACATGATTCAAAC
    GACATTATCGAAACAGTGTTATCAATGGGGATTTATCCAACATTGAAAGAAATATTACGT
    CATCGTGACATTGATGCAGGATTACCGAAAAGACCTTTCAAACCTTTTAACGAAGCACAT
    CGACAAACATTAGATCAACTCATTGCAAAATACGATTTATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0304 [new locus tag: SA_RS01755 ]
  • symbol: NanA
  • description: N-acetylneuraminate lyase
  • length: 293
  • theoretical pI: 4.64673
  • theoretical MW: 33100.4
  • GRAVY: -0.243003

Function[edit source | edit]

  • reaction:
    EC 4.1.3.3?  ExPASy
    N-acetylneuraminate lyaseN-acetylneuraminate = N-acetyl-D-mannosamine + pyruvate
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesN-acetylneuraminate lyase (TIGR00683; EC 4.1.3.3; HMM-score: 366.5)
    MetabolismCentral intermediary metabolismAmino sugarsN-acetylneuraminate lyase (TIGR00683; EC 4.1.3.3; HMM-score: 366.5)
    MetabolismAmino acid biosynthesisAspartate family4-hydroxy-tetrahydrodipicolinate synthase (TIGR00674; EC 4.3.3.7; HMM-score: 137.1)
    2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase (TIGR02313; EC 4.1.2.-; HMM-score: 100.4)
    5-dehydro-4-deoxyglucarate dehydratase (TIGR03249; EC 4.2.1.41; HMM-score: 56.6)
  • TheSEED:  
    Cell Wall and CapsuleCapsular and extracellular polysacchridesSialic Acid Metabolism N-acetylneuraminate lyase (EC 4.1.3.3) 
  • PFAM:
    TIM_barrel (CL0036) DHDPS; Dihydrodipicolinate synthetase family (PF00701; HMM-score: 280.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.149
    • Ymax_pos: 31
    • Cmax: 0.111
    • Cmax_pos: 23
    • Smax: 0.273
    • Smax_pos: 22
    • Smean: 0.161
    • D: 0.153
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNKDLKGLYAALLVPFDENGQVNEQGLKQIAQNAIETEELDGLYVNGSSGENFLLNTEQKKQVFKVAKEAVGDKVKLIAQVGSLDLNEAIELGKYATELGYDALSAVTPFYYPFTFEEIRDYYFDIIEATQNNMIIYAIPDLTGVNISIEQFSELFNHEKIVGVKYTAPNFFLLERIRKAFPDKLILSGFDEMLVQATISGVDGAIGSTYNVNGRRARKIFDLARQGQIQEAYQLQHDSNDIIETVLSMGIYPTLKEILRHRDIDAGLPKRPFKPFNEAHRQTLDQLIAKYDL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SA0306 (NanR*), CcpA
    NanR* (TF) important in N-acetylglucosamine utilization, Sialic acid utilizationRegPrecise
    CcpA (TF) important in Carbon catabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J. Microbiol. Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)