From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0410 [new locus tag: SA_RS02340 ]
  • pan locus tag?: SAUPAN002155000
  • symbol: SA0410
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0410 [new locus tag: SA_RS02340 ]
  • symbol: SA0410
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 468137..469339
  • length: 1203
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGGCTAAAATTCCAGTTACGGTATTAAGTGGTTATTTAGGCTCGGGGAAAACAACATTG
    TTAAATCATATTTTACAAAATCGTGAAGGTCGACGTATCGCGGTAATTGTAAATGATATG
    AGTGAAGTTAATATCGATAAAGATCTTGTCGCAGATGGTGGGGGACTATCGCGTACAGAT
    GAAAAATTAGTCGAACTCTCTAATGGTTGTATCTGTTGTACACTTAGAGATGATTTATTA
    AAAGAAGTTGAGCGTTTAGTGAAAAAAGGTGGCATCGATCAAATTGTTATTGAGTCAACA
    GGGATTTCAGAGCCAGTACCTGTTGCACAAACTTTCTCATATATTGATGATGAACTTGGC
    ATTGATCTTACAGCGATTTGCCGTTTAGATACAATGGTTACAGTTGTTGATGCTAACCGC
    TTCGTACATGACATCAACTCAGAAGATTTATTGATGGATCGTGATCAAAGCGTTGATGAA
    ACAGATGAACGTTCGATTGCTGATTTATTAATTGACCAAGTTGAATTTTGTGATGTATTG
    ATTATTAATAAAATTGATTTAATTAGTGAAGAAGAACTTGCAAAGTTAGAAAAAGTGTTA
    AGCGCATTGCAACCTATTGCTAAAATTATTAAGACAACAAATTCTGAAGTAGATTTAAAA
    GAAGTCTTAAATACGCAGCGTTTTGATTTTGAAAAAGCGAGCGAGTCAGCAGGATGGATC
    AAAGAACTTGAGTCGGGTGGTCATGCATCGCATACGCCTGAAACAGAAGAATATGGCATA
    TCATCATTTGTATATAAACGTCGTCTACCTTTCCATGCTAAAAGGTTCAATGATTGGTTA
    GAAAGCATGTCAAATAATGTCGTTCGATCAAAAGGTATCGTATGGTTAGCACAATACAAT
    CATGTAGCATGTTTATTATCTCAAGCAGGGTCATCTTGCAATATTCACCCAGTTACATAT
    TGGGTGGCTAGTATGTCTGAAGCGCAACAAACACAAATATTAGCAGAACGTCAAGATGTC
    GCAGCTGAATGGGATCCAGAATATGGCGATCGTCATACACAATTTGTCATTATTGGTACA
    GAATTAGATGAAGAAAAATTAACAAAAGAACTCGATGCATGCTTAGTCAATGCGCAAGAA
    ATTGATGCAGATTGGCAACAATTTGAAGATCCATATCAATGGCAAATTAGACCAGCACGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1203

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0410 [new locus tag: SA_RS02340 ]
  • symbol: SA0410
  • description: hypothetical protein
  • length: 400
  • theoretical pI: 4.30301
  • theoretical MW: 45017.5
  • GRAVY: -0.26275

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamincobalamin biosynthesis protein CobW (TIGR02475; HMM-score: 157.4)
    Genetic information processingProtein fateProtein modification and repairhydrogenase accessory protein HypB (TIGR00073; HMM-score: 26.8)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.7)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 16.8)
    MetabolismCentral intermediary metabolismNitrogen metabolismurease accessory protein UreG (TIGR00101; HMM-score: 15.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMolybdopterinmolybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 14.5)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 14.1)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.5)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 13.2)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 13.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.2)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.2)
    Unknown functionGeneralGTP-binding protein HflX (TIGR03156; HMM-score: 10.9)
  • TheSEED:  
    Metal chaperone, involved in Zn homeostasis 
  • PFAM:
    P-loop_NTPase (CL0023) cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 199.9)
    no clan definedCobW_C; Cobalamin synthesis protein cobW C-terminal domain (PF07683; HMM-score: 92.1)
    P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.1)
    AAA_23; AAA domain (PF13476; HMM-score: 19.5)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 18.2)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 17.7)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 17.2)
    PspA (CL0235) Snf7; Snf7 (PF03357; HMM-score: 16.9)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.4)
    no clan definedMMR_HSR1_Xtn; C-terminal region of MMR_HSR1 domain (PF16897; HMM-score: 16.2)
    P-loop_NTPase (CL0023) MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 15.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.3)
    AAA_18; AAA domain (PF13238; HMM-score: 13.9)
    ArgK; ArgK protein (PF03308; HMM-score: 13.3)
    NACHT; NACHT domain (PF05729; HMM-score: 13.2)
    AAA_33; AAA domain (PF13671; HMM-score: 13.1)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13)
    ABC_tran; ABC transporter (PF00005; HMM-score: 12.9)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.1)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 11.8)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA0843(fab)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1377(glcK)glucokinase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0458(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [1] (data from MRSA252)
    SA1308(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA0708(secA)preprotein translocase subunit SecA  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0372hypothetical protein  [1] (data from MRSA252)
    SA0422hypothetical protein  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA2327pyruvate oxidase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.164
    • Ymax_pos: 12
    • Cmax: 0.108
    • Cmax_pos: 52
    • Smax: 0.352
    • Smax_pos: 4
    • Smean: 0.278
    • D: 0.209
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAKIPVTVLSGYLGSGKTTLLNHILQNREGRRIAVIVNDMSEVNIDKDLVADGGGLSRTDEKLVELSNGCICCTLRDDLLKEVERLVKKGGIDQIVIESTGISEPVPVAQTFSYIDDELGIDLTAICRLDTMVTVVDANRFVHDINSEDLLMDRDQSVDETDERSIADLLIDQVEFCDVLIINKIDLISEEELAKLEKVLSALQPIAKIIKTTNSEVDLKEVLNTQRFDFEKASESAGWIKELESGGHASHTPETEEYGISSFVYKRRLPFHAKRFNDWLESMSNNVVRSKGIVWLAQYNHVACLLSQAGSSCNIHPVTYWVASMSEAQQTQILAERQDVAAEWDPEYGDRHTQFVIIGTELDEEKLTKELDACLVNAQEIDADWQQFEDPYQWQIRPAR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA0410 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1383 (Zur*)
    Zur* (TF) important in Zinc homeostasisRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]