From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0429 [new locus tag: SA_RS02440 ]
  • pan locus tag?: SAUPAN002185000
  • symbol: gltC
  • pan gene symbol?: gltC
  • synonym:
  • product: transcription activator of glutamate synthase operon

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0429 [new locus tag: SA_RS02440 ]
  • symbol: gltC
  • product: transcription activator of glutamate synthase operon
  • replicon: chromosome
  • strand: -
  • coordinates: 489599..490483
  • length: 885
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGAAATTAAACAATTAAGATATTTTATCGAGGTCGCTAAAAGAGAACATATCTCCGAA
    ACAGCACTTGAACTAAACATTGCTCAATCAGCGATAAGCCGTCAAATTACATTATTAGAA
    CAAGAACTTAATGTGTCTTTATTTAAAAAGCAAGGACGCAATATTACGCTCACATCTGAA
    GGGAAATTATTATTTAATGAAGCTCTGCGTATTATTGAACATTTAGATAGCACGATTGAA
    CAATTTCAAAGCCATGGATTAACTAAAAATAAAAGTATCTACATTGGCTATGATGAGAGT
    GACGTATCCCACATGTTACTACCACTTATCCAAACGTTTCATTTACAAAATGATACACAT
    GTCATACCGAGCTTATTAGATCATGACACGATTATAAATAGCGTATTAAATGGGAATATA
    GACATTGGTTTCACGGAACTTACACCAGAAATACGTAAACACAAACAATTACATATGCTA
    CCTTTATTCGAAGAGCACTATCATTTATATGCGCCTTCAGACGATCCAATTACGATGGCG
    ACACACCCACCATTAATTCAGTTTGAGCATAGTCATATTTATTGCTTGGCACCATTTGCC
    GAAACTGTAAAAAAACAATTGCGCAAGATTACTAAATCAGATGTATACACAATCAGTAGC
    CAACCACTTGCGCAGTATCTCCTTCGTCAAAAAGAAGGTTACATCATTTCATCACAAAAT
    ATACATTTACCAGAATCTAAATCATGGATAGATATAAAATTAGATCATACTGAATTAAAA
    AGAACGATATGTGCTATTACAAAGGAGCCTTATACAAAGAGTGATATTGGCATATTATTA
    ACACTTATTCAGCAATTAATGACTAAAACGTCTACATTCCATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0429 [new locus tag: SA_RS02440 ]
  • symbol: GltC
  • description: transcription activator of glutamate synthase operon
  • length: 294
  • theoretical pI: 6.76422
  • theoretical MW: 33928.8
  • GRAVY: -0.257823

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    putative choline sulfate-utilization transcription factor (TIGR03418; HMM-score: 66.4)
    MetabolismEnergy metabolismOtherpca operon transcription factor PcaQ (TIGR02424; HMM-score: 58.8)
    Signal transductionRegulatory functionsDNA interactionspca operon transcription factor PcaQ (TIGR02424; HMM-score: 58.8)
    Signal transductionRegulatory functionsDNA interactionsaminoethylphosphonate catabolism associated LysR family transcriptional regulator (TIGR03339; HMM-score: 50.7)
    Signal transductionRegulatory functionsDNA interactionsD-serine deaminase transcriptional activator (TIGR02036; HMM-score: 40.7)
    Cellular processesCellular processesToxin production and resistancetranscriptional regulator, ArgP family (TIGR03298; HMM-score: 29.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscriptional regulator, ArgP family (TIGR03298; HMM-score: 29.4)
    Signal transductionRegulatory functionsDNA interactionstranscriptional regulator, ArgP family (TIGR03298; HMM-score: 29.4)
  • TheSEED:  
    Regulation and Cell signalingRegulation and Cell signaling - no subcategoryDNA-binding regulatory proteins, strays GltC, transcription activator of glutamate synthase operon 
  • PFAM:
    HTH (CL0123) HTH_1; Bacterial regulatory helix-turn-helix protein, lysR family (PF00126; HMM-score: 64.2)
    PBP (CL0177) LysR_substrate; LysR substrate binding domain (PF03466; HMM-score: 32.9)
    no clan definedRibosomal_S13_N; Ribosomal S13/S15 N-terminal domain (PF08069; HMM-score: 17.2)
    HTH (CL0123) HTH_34; Winged helix DNA-binding domain (PF13601; HMM-score: 16.3)
    HTH_5; Bacterial regulatory protein, arsR family (PF01022; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.1
    • Ymax_pos: 31
    • Cmax: 0.115
    • Cmax_pos: 31
    • Smax: 0.116
    • Smax_pos: 30
    • Smean: 0.087
    • D: 0.095
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15926148 NCBI
  • RefSeq: NP_373681 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MEIKQLRYFIEVAKREHISETALELNIAQSAISRQITLLEQELNVSLFKKQGRNITLTSEGKLLFNEALRIIEHLDSTIEQFQSHGLTKNKSIYIGYDESDVSHMLLPLIQTFHLQNDTHVIPSLLDHDTIINSVLNGNIDIGFTELTPEIRKHKQLHMLPLFEEHYHLYAPSDDPITMATHPPLIQFEHSHIYCLAPFAETVKKQLRKITKSDVYTISSQPLAQYLLRQKEGYIISSQNIHLPESKSWIDIKLDHTELKRTICAITKEPYTKSDIGILLTLIQQLMTKTSTFH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: CodY, GltC
    CodY (TF) important in Amino acid metabolismRegPrecise
    GltC (TF) important in Glutamate metabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]