From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0432 [new locus tag: SA_RS02460 ]
  • pan locus tag?: SAUPAN002190000
  • symbol: treP
  • pan gene symbol?: treP
  • synonym:
  • product: PTS trehalose-specific transporter subunit II

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0432 [new locus tag: SA_RS02460 ]
  • symbol: treP
  • product: PTS trehalose-specific transporter subunit II
  • replicon: chromosome
  • strand: +
  • coordinates: 497474..498901
  • length: 1428
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGCTGTAAAAAGAGAAGATGTAAAAGCCATCGTAAGCGCTATTGGGGGAAAAGAAAAT
    CTTGAAGCTGCAACGCATTGTGTAACACGATTACGTTTAGTGCTTAAAGATGAAAGCAAA
    GTTGATAAAGACGCATTAAGTAATAACGCGTTGGTCAAGGGGCAGTTCAAAGCAGACCAT
    CAATATCAAATTGTCATTGGTCCAGGAACAGTCGATGAAGTGTATAAGCAGTTTATTGAT
    GAAACAGGTGCTCAAGAAGCTTCGAAAGATGAAGCGAAACAAGCAGCTGCGAAAAAAGGG
    AATCCAGTACAACGTTTGATCAAATTGTTAGGGGATATTTTTATACCAATATTACCTGCG
    ATTGTGACAGCTGGTTTGTTAATGGGGATCAATAATTTACTTACAATGAAAGGTTTATTT
    GGTCCAAAAGCACTTATTGAGATGTATCCGCAAATTGCTGATATTTCAAACATCATTAAT
    GTGATTGCGAGTACGGCATTTATTTTCTTACCAGCATTAATTGGTTGGAGTAGTATGCGT
    GTATTTGGTGGTAGTCCGATTCTAGGCATAGTCTTAGGTTTGATTTTAATGCATCCGCAA
    TTAGTATCTCAGTATGATTTGGCAAAAGGGAATATTCCGACGTGGAACTTATTTGGCTTA
    GAGATTAAGCAGTTGAATTACCAAGGTCAAGTGTTGCCTGTTTTAATTGCAGCTTATGTT
    CTAGCTAAAATTGAAAAAGGATTAAATAAAGTCGTTCACGATTCGATAAAAATGTTGGTC
    GTTGGACCCGTAGCGCTTTTAGTTACTGGATTTTTAGCATTTATTATCATTGGACCAGTT
    GCATTATTGATTGGTACAGGTATTACATCTGGTGTTACATTTATATTCCAACATGCAGGA
    TGGCTTGGCGGAGCAATATATGGATTGTTATATGCACCACTTGTAATTACAGGACTACAC
    CATATGTTTTTAGCAGTAGATTTCCAATTGATGGGTAGCAGCTTAGGTGGTACGTATTTA
    TGGCCAATTGTTGCGATTTCCAATATTTGTCAGGGCTCTGCAGCATTTGGAGCATGGTTT
    GTCTATAAACGTCGTAAAATGGTTAAAGAAGAAGGCTTGGCATTAACATCTTGTATTTCT
    GCTATGTTAGGTGTTACTGAACCAGCTATGTTTGGTGTGAACTTACCTTTGAAATATCCA
    TTTATCGCTGCGATATCAACGTCTTGTGTATTGGGGGCAATCGTTGGTATGAATAACGTA
    CTTGGAAAAGTTGGTGTTGGTGGCGTGCCAGCATTCATTTCAATTCAAAAAGAATTTTGG
    CCAGTATATCTTATTGTGACAGCTATTGCTATTGTTGTACCATGTATACTAACAATTGTG
    ATGTCTCATTTTAGTAAACAAAAAGCGAAAGAAATTGTTGAAGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1428

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0432 [new locus tag: SA_RS02460 ]
  • symbol: TreP
  • description: PTS trehalose-specific transporter subunit II
  • length: 475
  • theoretical pI: 9.1912
  • theoretical MW: 50937.3
  • GRAVY: 0.626737

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    PTS system, trehalose-specific IIBC component (TIGR01992; EC 2.7.1.69; HMM-score: 703.8)
    PTS system, sucrose-specific IIBC component (TIGR01996; EC 2.7.1.69; HMM-score: 514.4)
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 340.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234.8)
    Signal transductionSignal transductionPTSPTS system, maltose and glucose-specific subfamily, IIC component (TIGR00852; HMM-score: 234.8)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 84)
    Signal transductionSignal transductionPTSPTS system, glucose-like IIB component (TIGR00826; EC 2.7.1.69; HMM-score: 84)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, N-acetylglucosamine-specific IIBC component (TIGR01998; EC 2.7.1.69; HMM-score: 44.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, maltose and glucose-specific IIBC component (TIGR02004; EC 2.7.1.69; HMM-score: 38)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, alpha-glucoside-specific IIBC component (TIGR02005; EC 2.7.1.69; HMM-score: 37.6)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, glucose-specific IIBC component (TIGR02002; EC 2.7.1.69; HMM-score: 25.2)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, IIBC component (TIGR02003; EC 2.7.1.69; HMM-score: 22.1)
  • TheSEED:  
    Trehalose Uptake and Utilization PTS system, trehalose-specific IIB component (EC 2.7.1.69) / PTS system, trehalose-specific IIC component 
  • PFAM:
    PTS_EIIC (CL0493) PTS_EIIC; Phosphotransferase system, EIIC (PF02378; HMM-score: 142.3)
    no clan definedPTS_EIIB; phosphotransferase system, EIIB (PF00367; HMM-score: 57.4)
    MotA_ExbB; MotA/TolQ/ExbB proton channel family (PF01618; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1533(ackA)acetate kinase  [1] (data from MRSA252)
    SA0562(adh1)alcohol dehydrogenase  [1] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [1] (data from MRSA252)
    SA2427(arcB)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1184(citB)aconitate hydratase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1394(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [1] (data from MRSA252)
    SA0376(guaA)GMP synthase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA0475(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA0494(nusG)transcription antitermination protein  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0865(ppnK)inorganic polyphosphate/ATP-NAD kinase  [1] (data from MRSA252)
    SA1106(proS)prolyl-tRNA synthetase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA2341(rocA)1-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2032(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA0500(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA1382(sodA)superoxide dismutase SodA  [1] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [1] (data from MRSA252)
    SA1088(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SA1506(thrS)threonyl-tRNA synthetase  [1] (data from MRSA252)
    SA1499(tig)trigger factor  [1] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SA0992(trxA)thioredoxin  [1] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0342hypothetical protein  [1] (data from MRSA252)
    SA0587hypothetical protein  [1] (data from MRSA252)
    SA0760glycine cleavage system protein H  [1] (data from MRSA252)
    SA0774hypothetical protein  [1] (data from MRSA252)
    SA0873hypothetical protein  [1] (data from MRSA252)
    SA1443hypothetical protein  [1] (data from MRSA252)
    SA1599translaldolase  [1] (data from MRSA252)
    SA2202hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 9
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.155
    • Ymax_pos: 24
    • Cmax: 0.207
    • Cmax_pos: 24
    • Smax: 0.209
    • Smax_pos: 41
    • Smean: 0.115
    • D: 0.139
  • predicted transmembrane helices (TMHMM): 9

Accession numbers[edit source | edit]

  • GI: 15926151 NCBI
  • RefSeq: NP_373684 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAVKREDVKAIVSAIGGKENLEAATHCVTRLRLVLKDESKVDKDALSNNALVKGQFKADHQYQIVIGPGTVDEVYKQFIDETGAQEASKDEAKQAAAKKGNPVQRLIKLLGDIFIPILPAIVTAGLLMGINNLLTMKGLFGPKALIEMYPQIADISNIINVIASTAFIFLPALIGWSSMRVFGGSPILGIVLGLILMHPQLVSQYDLAKGNIPTWNLFGLEIKQLNYQGQVLPVLIAAYVLAKIEKGLNKVVHDSIKMLVVGPVALLVTGFLAFIIIGPVALLIGTGITSGVTFIFQHAGWLGGAIYGLLYAPLVITGLHHMFLAVDFQLMGSSLGGTYLWPIVAISNICQGSAAFGAWFVYKRRKMVKEEGLALTSCISAMLGVTEPAMFGVNLPLKYPFIAAISTSCVLGAIVGMNNVLGKVGVGGVPAFISIQKEFWPVYLIVTAIAIVVPCILTIVMSHFSKQKAKEIVED

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SA0434 (TreR*), CcpA
    TreR* (TF) important in Trehalose utilization  RegPrecise
    CcpA (TF) important in Carbon catabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 1.62 1.63 1.64 1.65 1.66 1.67 1.68 1.69 1.70 1.71 1.72 1.73 1.74 1.75 1.76 1.77

Relevant publications[edit source | edit]