From AureoWiki
Jump to: navigation, search

NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0551 [new locus tag: SA_RS03185 ]
  • pan locus tag?: SAUPAN002375000
  • symbol: SA0551
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0551 [new locus tag: SA_RS03185 ]
  • symbol: SA0551
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 644319..645767
  • length: 1449
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    TTGCTCGTAATATTGCAACTACCATGTCACATTATCAGCAAGACGAACAGAATATCATTA
    TTAATTTTTATAATGAAAAAACAATCAAAGATGTCATTGAAGACATTCAAAAGGAGGATT
    TATGTCATGAAAACATATGATTTAATTGTAATAGGATTTGGGAAAGCTGGTAAAACTTTA
    GCGAAATATGCTGCATCAACAGGTCAACACGTCGCAGTTATCGAACAATCTTCGAAAATG
    TATGGCGGCACTTGTATAAATATAGGATGTATACCTTCGAAGACACTTGTACATGATGGA
    TTAGAAGGCAAATCTTTTGAAGCAAGTTATAACCGTAAAAACGATGTTGTCAATGCGCTA
    AACAATAAAAATTACCACTTATTAGCAGACGATAACAACATTGATGTATTGGATTTTAAA
    GCGCAGTTTAAATCTAATACTGAAGTGAATTTATTAGATCAGCATGGCGATATCGTCGAT
    AGTATTACTGCACCTCATATCATTATTAATACCGGTGCTACCTCTATCATTCCTAACATA
    AAAGGCCTTGATCAAGCTAAACATGTCTTCGATTCAACAGGTTTATTAAACATTAGCTAT
    CAACCTAAGCATCTCGTTATTGTAGGTGGCGGTTATATTGCCTTAGAATTTGCTTCAATG
    TTTGCGAATTTAGGTAGTAAGGTAACAGTATTAGAACGTGGTGAATCATTTATGCCACGC
    GAAGATCAAGATGTCGTTGCACATGCTATTACTGACTTAGAAAATAAAGGCATTGCATTG
    CATACAAATGTTGAAACGACTGAATTGTCATCTGACGATCATCATACAACAGTCCGTACT
    AATGTTGGCAACTTTGAGGCTGATGCAGTACTTTTGGCTATCGGGCGCAAACCGAATACA
    GCCTTAGCTTTAGAAAATACTGATATCGAATTAGGTGATAGAGGCGAAATTAAAGTCAAT
    GCTCAACTTCAAACATCTGTGCCACATATTTATGCTGCAGGTGATGTTAAAGGCGGACTT
    CAATTTACGTATATATCTTTAGATGATTATCGAATTATCAAATCAGCGTTATATGGTAAT
    CAGTCACGTACGACTGACAATAGAGGTAGCGTGCCTTATACAGTATTTATAGATCCACCA
    TTATCACGTGTTGGATTAACTAGTAAAGAAGCTGCCGCTCAACATTATGATTACACTGAA
    CATCAACTTTTAGTAAGTGCTATACCTCGTCACAAAATTAACAATGATCCAAGAGGTTTA
    TTTAAAGTAGTCATTAATAATGAAAATAATATGATTTTAGGTGCTACATTATATGGTAAG
    CAATCTGAAGAATTAATTAATATAATTAAACTTGCGATTGATCAAAACATTCCATATACC
    GTATTACGAGATAATATTTATACACATCCTACGATGGCCGAATCATTTAATGATTTATTT
    AATTTCTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1449

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0551 [new locus tag: SA_RS03185 ]
  • symbol: SA0551
  • description: hypothetical protein
  • length: 482
  • theoretical pI: 6.99987
  • theoretical MW: 53318.4
  • GRAVY: -0.15249

Function[edit source | edit]

  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 321)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 305.4)
    and 41 more
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 243.9)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 204.7)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 200.8)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 161.2)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 148.6)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 122.6)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 92.7)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 78.6)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 67.1)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 67.1)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 60.2)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 52.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 49.9)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 49.2)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 40)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 38)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 37.9)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 34)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 34)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 31.9)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 28)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 26)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 25.4)
    Genetic information processingProtein fateProtein folding and stabilizationxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 22.4)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesOtherxanthine dehydrogenase accessory protein XdhC (TIGR02964; HMM-score: 22.4)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 19.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 18.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 17.5)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 17.3)
    Cellular processesCellular processesSporulation and germinationdipicolinic acid synthetase, A subunit (TIGR02853; HMM-score: 17.2)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 15.9)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 15.2)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 14.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsputative uridylate kinase (TIGR02076; EC 2.7.4.-; HMM-score: 14.9)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 14.7)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 14.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 13.6)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 12.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 11.2)
    lycopene cyclase family protein (TIGR01790; HMM-score: 10.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 9.5)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismTCA Cycle Putative Dihydrolipoamide dehydrogenase (EC 1.8.1.4) 
    and 3 more
    Virulence, Disease and DefenseResistance to antibiotics and toxic compoundsMercuric reductase Mercuric ion reductase (EC 1.16.1.1) 
    Resistance to antibiotics and toxic compoundsMercuric reductase PF00070 family, FAD-dependent NAD(P)-disulphide oxidoreductase 
    Resistance to antibiotics and toxic compoundsMercury resistance operon Mercuric ion reductase (EC 1.16.1.1) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 204.6)
    and 21 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 81.7)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 81)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 52.2)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 33.8)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 28.6)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 27.4)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 26.2)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 26)
    2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 24.7)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 23)
    Thi4; Thi4 family (PF01946; HMM-score: 22.9)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 22.3)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 21.7)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 21.3)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 20.3)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 19.8)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 16.2)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 15.9)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15.9)
    no clan definedDUF4147; Domain of unknown function (DUF4147) (PF13660; HMM-score: 13.4)
    NADP_Rossmann (CL0063) Sacchrp_dh_NADP; Saccharopine dehydrogenase NADP binding domain (PF03435; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.194
    • Ymax_pos: 14
    • Cmax: 0.133
    • Cmax_pos: 32
    • Smax: 0.445
    • Smax_pos: 5
    • Smean: 0.338
    • D: 0.25
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLVILQLPCHIISKTNRISLLIFIMKKQSKMSLKTFKRRIYVMKTYDLIVIGFGKAGKTLAKYAASTGQHVAVIEQSSKMYGGTCINIGCIPSKTLVHDGLEGKSFEASYNRKNDVVNALNNKNYHLLADDNNIDVLDFKAQFKSNTEVNLLDQHGDIVDSITAPHIIINTGATSIIPNIKGLDQAKHVFDSTGLLNISYQPKHLVIVGGGYIALEFASMFANLGSKVTVLERGESFMPREDQDVVAHAITDLENKGIALHTNVETTELSSDDHHTTVRTNVGNFEADAVLLAIGRKPNTALALENTDIELGDRGEIKVNAQLQTSVPHIYAAGDVKGGLQFTYISLDDYRIIKSALYGNQSRTTDNRGSVPYTVFIDPPLSRVGLTSKEAAAQHYDYTEHQLLVSAIPRHKINNDPRGLFKVVINNENNMILGATLYGKQSEELINIIKLAIDQNIPYTVLRDNIYTHPTMAESFNDLFNF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]