From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0654 [new locus tag: SA_RS03730 ]
  • pan locus tag?: SAUPAN002583000
  • symbol: fruB
  • pan gene symbol?: fruB
  • synonym:
  • product: fructose 1-phosphate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0654 [new locus tag: SA_RS03730 ]
  • symbol: fruB
  • product: fructose 1-phosphate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 747089..748009
  • length: 921
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGATTTATACAGTGACTTTCAATCCTTCAATTGACTATGTCATTTTTACGAATGATTTT
    AAAATTGATGGTTTGAACAGAGCAACAGCAACATATAAATTCGCTGGGGGGAAAGGTATT
    AATGTCTCGCGCGTCTTAAAGACATTAGATGTTGAGTCAACTGCCTTGGGATTTGCAGGT
    GGATTTCCTGGGAAATTCATTATAGATACATTAAATAACAGTGCAATTCAATCGAATTTT
    ATTGAAGTTGATGAAGATACACGTATTAATGTGAAATTAAAAACAGGACAAGAAACAGAA
    ATCAATGCACCGGGTCCTCATATAACGTCAACACAATTTGAACAACTGTTACAACAAATT
    AAAAATACAACAAGCGAAGATATAGTTATTGTTGCTGGAAGTGTACCAAGTAGTATTCCA
    AGCGATGCGTATGCGCAAATTGCACAAATTACAGCACAGACAGGTGCTAAATTAGTAGTC
    GACGCTGAAAAAGAATTGGCTGAAAGCGTTTTACCATTTCATCCACTATTTATTAAACCT
    AATAAAGATGAATTAGAAGTGATGTTTAATACAACAGTGAACTCAGACACAGATGTTATT
    AAATATGGTCGTTTGTTAGTTGATAAAGGTGCGCAATCTGTTATTGTCTCGCTTGGCGGT
    GATGGTGCTATTTATATTGATAAAGAAATCAGTATTAAAGCAGTTAATCCACAAGGGAAA
    GTGGTTAATACAGTTGGCTCTGGTGATAGTACAGTTGCAGGCATGGTGGCTGGAATTGCT
    TCAGGTTTAACGATTGAAAAAGCATTCCAACAAGCAGTCGCATGCGGTACTGCCACGGCA
    TTTGATGAGGACTTAGCAACACGGGACGCTATAGAAAAAATAAAATCACAAGTTACGATT
    AGCGTACTTGATGGGGAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    921

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0654 [new locus tag: SA_RS03730 ]
  • symbol: FruB
  • description: fructose 1-phosphate kinase
  • length: 306
  • theoretical pI: 4.39114
  • theoretical MW: 32556.6
  • GRAVY: 0.0382353

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    1-phosphofructokinase (TIGR03828; EC 2.7.1.56; HMM-score: 354)
    hexose kinase, 1-phosphofructokinase family (TIGR03168; EC 2.7.1.-; HMM-score: 352.8)
    MetabolismEnergy metabolismBiosynthesis and degradation of polysaccharidestagatose-6-phosphate kinase (TIGR01231; EC 2.7.1.144; HMM-score: 177.4)
    MetabolismEnergy metabolismSugarsribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 64.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesbifunctional protein RfaE, domain I (TIGR02198; EC 2.7.1.-; HMM-score: 52.1)
    MetabolismEnergy metabolismSugars5-dehydro-2-deoxygluconokinase (TIGR04382; EC 2.7.1.92; HMM-score: 42.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminehydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 36.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridoxinepyridoxal kinase (TIGR00687; EC 2.7.1.35; HMM-score: 21.6)
  • TheSEED:  
    CarbohydratesMonosaccharidesFructose utilization 1-phosphofructokinase (EC 2.7.1.56) 
  • PFAM:
    Ribokinase (CL0118) PfkB; pfkB family carbohydrate kinase (PF00294; HMM-score: 174.3)
    Phos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 35)
    Carb_kinase; Carbohydrate kinase (PF01256; HMM-score: 23.1)
    HTH (CL0123) PuR_N; Bacterial purine repressor, N-terminal (PF09182; HMM-score: 14.4)
    NADP_Rossmann (CL0063) GRDA; Glycine reductase complex selenoprotein A (PF04723; HMM-score: 14.3)
    SIS (CL0067) DUF2529; Domain of unknown function (DUF2529) (PF10740; HMM-score: 11.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.126
    • Ymax_pos: 31
    • Cmax: 0.154
    • Cmax_pos: 31
    • Smax: 0.13
    • Smax_pos: 26
    • Smean: 0.092
    • D: 0.113
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15926376 NCBI
  • RefSeq: NP_373909 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MIYTVTFNPSIDYVIFTNDFKIDGLNRATATYKFAGGKGINVSRVLKTLDVESTALGFAGGFPGKFIIDTLNNSAIQSNFIEVDEDTRINVKLKTGQETEINAPGPHITSTQFEQLLQQIKNTTSEDIVIVAGSVPSSIPSDAYAQIAQITAQTGAKLVVDAEKELAESVLPFHPLFIKPNKDELEVMFNTTVNSDTDVIKYGRLLVDKGAQSVIVSLGGDGAIYIDKEISIKAVNPQGKVVNTVGSGDSTVAGMVAGIASGLTIEKAFQQAVACGTATAFDEDLATRDAIEKIKSQVTISVLDGE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SA0653 (FruR*), CcpA
    FruR* (TF) important in Fructose utilizationRegPrecise
    CcpA (TF) important in Carbon catabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)

Relevant publications[edit source | edit]