From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0719 [new locus tag: SA_RS04090 ]
  • pan locus tag?: SAUPAN002684000
  • symbol: trxB
  • pan gene symbol?: trxB
  • synonym:
  • product: thioredoxine reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0719 [new locus tag: SA_RS04090 ]
  • symbol: trxB
  • product: thioredoxine reductase
  • replicon: chromosome
  • strand: +
  • coordinates: 822228..823163
  • length: 936
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGACTGAAATAGATTTTGATATAGCAATTATCGGTGCAGGTCCAGCTGGTATGACTGCT
    GCAGTATACGCATCACGTGCTAATTTAAAAACAGTTATGATTGAAAGAGGTATTCCAGGC
    GGTCAAATGGCTAATACAGAAGAAGTAGAGAACTTCCCTGGTTTCGAAATGATTACAGGT
    CCAGATTTATCTACAAAAATGTTTGAACACGCTAAAAAGTTTGGTGCAGTTTATCAATAT
    GGAGATATTAAATCTGTAGAAGATAAAGGCGAATATAAAGTGATTAACTTTGGTAATAAA
    GAATTAACAGCGAAAGCGGTCATTATTGCTACAGGTGCAGAATACAAGAAAATTGGTGTT
    CCGGGTGAACAAGAACTTGGTGGACGCGGTGTAAGTTATTGTGCAGTATGTGATGGTGCA
    TTCTTTAAAAATAAACGCCTATTCGTTATCGGTGGTGGTGACTCAGCAGTAGAAGAGGGA
    ACATTCTTAACTAAATTTGCTGACAAAGTAACAATCGTTCACCGTCGTGATGAGTTACGT
    GCACAGCGTATTTTACAAGATAGAGCATTCAAAAATGATAAAATCGACTTTATTTGGAGT
    CATACTTTGAAATCAATTAATGAAAAAGACGGCAAAGTGGGTTCTGTGACATTAACGTCT
    ACAAAAGATGGTTCAGAAGAAACACACGAGGCTGATGGTGTATTCATCTATATTGGTATG
    AAACCATTAACAGCGCCATTTAAAGACTTAGGTATTACGAATGATGTTGGTTATATTGTG
    ACAAAAGATGATATGACAACATCAGTACCAGGTATTTTTGCAGCAGGAGATGTTCGTGAC
    AAAGGTTTACGCCAAATTGTCACTGCTACTGGCGATGGTAGTATTGCAGCGCAAAGTGCA
    GCGGAATATATTGAACATTTAAACGATCAAGCTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    936

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0719 [new locus tag: SA_RS04090 ]
  • symbol: TrxB
  • description: thioredoxine reductase
  • length: 311
  • theoretical pI: 5.00403
  • theoretical MW: 33615.8
  • GRAVY: -0.218006

Function[edit source | edit]

  • reaction:
    EC 1.8.1.9?  ExPASy
    Thioredoxin-disulfide reductaseThioredoxin + NADP+ = thioredoxin disulfide + NADPH
  • TIGRFAM:
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 398.3)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 303.7)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 255.2)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 255.2)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 98.1)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 94.6)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 87.6)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 52.1)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 48.5)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 47.9)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 46.4)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 45.8)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 42.8)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 42.7)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 40.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 35.1)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 30)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 28.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 28.8)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 24.8)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 24.3)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 23)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 21.4)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 19.4)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 16.6)
    lycopene cyclase family protein (TIGR01790; HMM-score: 16.2)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 16.2)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 16.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 15.8)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 15.4)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 15.3)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 15.2)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 15.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 14.9)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 14.7)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 14.7)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 14.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 14.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 13)
    fumarate reductase (quinol), flavoprotein subunit (TIGR01176; EC 1.3.5.4; HMM-score: 12.3)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, monomeric form (TIGR01377; HMM-score: 11.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 11.5)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinespyrimidine conversions Thioredoxin reductase (EC 1.8.1.9) 
    Sulfur MetabolismSulfur Metabolism - no subcategoryThioredoxin-disulfide reductase Thioredoxin reductase (EC 1.8.1.9) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 179.2)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 88.5)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 76.5)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 36.2)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 34.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 32.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 29.4)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 29.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 28.1)
    Thi4; Thi4 family (PF01946; HMM-score: 27.9)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 23.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 23.2)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 19.5)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 17.8)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 16.7)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 12.2)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 12.1)
    no clan definedBBS2_C; Ciliary BBSome complex subunit 2, C-terminal (PF14782; HMM-score: 10.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 45
    • Cmax: 0.156
    • Cmax_pos: 24
    • Smax: 0.219
    • Smax_pos: 42
    • Smean: 0.115
    • D: 0.146
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTEIDFDIAIIGAGPAGMTAAVYASRANLKTVMIERGIPGGQMANTEEVENFPGFEMITGPDLSTKMFEHAKKFGAVYQYGDIKSVEDKGEYKVINFGNKELTAKAVIIATGAEYKKIGVPGEQELGGRGVSYCAVCDGAFFKNKRLFVIGGGDSAVEEGTFLTKFADKVTIVHRRDELRAQRILQDRAFKNDKIDFIWSHTLKSINEKDGKVGSVTLTSTKDGSEETHEADGVFIYIGMKPLTAPFKDLGITNDVGYIVTKDDMTTSVPGIFAAGDVRDKGLRQIVTATGDGSIAAQSAAEYIEHLNDQA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J. Microbiol. Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)