From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0977 [new locus tag: SA_RS05540 ]
  • pan locus tag?: SAUPAN003359000
  • symbol: isdA
  • pan gene symbol?: isdA
  • synonym:
  • product: cell surface protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0977 [new locus tag: SA_RS05540 ]
  • symbol: isdA
  • product: cell surface protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1106798..1107850
  • length: 1053
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGACAAAACATTATTTAAACAGTAAGTATCAATCAGAACAACGTTCATCAGCTATGAAA
    AAGATTACAATGGGTACAGCATCTATCATTTTAGGTTCCCTTGTATACATAGGCGCAGAC
    AGCCAACAAGTCAATGCGGCAACAGAAGCTACGAACGCAACTAATAATCAAAGCACACAA
    GTTTCTCAAGCAACATCACAACCAATTAATTTCCAAGTGCAAAAAGATGGCTCTTCAGAG
    AAGTCACACATGGATGACTATATGCAACACCCTGGTAAAGTAATTAAACAAAATAATAAA
    TATTATTTCCAAACCGTGTTAAACAATGCATCATTCTGGAAAGAATACAAATTTTACAAT
    GCAAACAATCAAGAATTAGCAACAACTGTTGTTAACGATAATAAAAAAGCGGATACTAGA
    ACAATCAATGTTGCAGTTGAACCTGGATATAAGAGCTTAACTACTAAAGTACATATTGTC
    GTGCCACAAATTAATTACAATCATAGATATACTACGCATTTGGAATTTGAAAAAGCAATT
    CCTACATTAGCTGACGCAGCAAAACCAAACAATGTTAAACCGGTTCAACCAAAACCAGCT
    CAACCTAAAACACCTACTGAGCAAACTAAACCAGTTCAACCTAAAGTTGAAAAAGTTAAA
    CCTACTGTAACTACAACAAGCAAAGTTGAAGACAATCACTCTACTAAAGTTGTAAGTACT
    GACACAACAAAAGATCAAACTAAAACACAAACTGCTCATACAGTTAAAACAGCACAAACT
    GCTCAAGAACAAAATAAAGTTCAAACACCTGTTAAAGATGTTGCAACAGCGAAATCTGAA
    AGCAACAATCAAGCTGTAAGTGATAATAAATCACAACAAACTAACAAAGTTACAAAACAT
    AACGAAACGCCTAAACAAGCATCTAAAGCTAAAGAATTACCAAAAACTGGTTTAACTTCA
    GTTGATAACTTTATTAGCACAGTTGCCTTCGCAACACTTGCCCTTTTAGGTTCATTATCT
    TTATTACTTTTCAAAAGAAAAGAATCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1053

Protein[edit source | edit]

Protein Data Bank: 3QZL
Protein Data Bank: 3QZM
Protein Data Bank: 3QZN
Protein Data Bank: 3QZO
Protein Data Bank: 3QZP
Protein Data Bank: 2ITE
Protein Data Bank: 2ITF

General[edit source | edit]

  • locus tag: SA0977 [new locus tag: SA_RS05540 ]
  • symbol: IsdA
  • description: cell surface protein
  • length: 350
  • theoretical pI: 10.2642
  • theoretical MW: 38745.2
  • GRAVY: -0.817714

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    heme uptake protein IsdC (TIGR03656; HMM-score: 60.1)
    Cell structureCell envelopeOtherLPXTG cell wall anchor domain (TIGR01167; HMM-score: 22.5)
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 16)
    pullulanase, extracellular (TIGR02102; HMM-score: 9.8)
  • TheSEED:  
    Cell Wall and CapsuleGram-Positive cell wall componentsSortase Cell surface protein IsdA, transfers heme from hemoglobin to apo-IsdC 
    Iron acquisition and metabolismIron acquisition and metabolism - no subcategoryHeme, hemin uptake and utilization systems in GramPositives Cell surface protein IsdA, transfers heme from hemoglobin to apo-IsdC 
  • PFAM:
    no clan definedNEAT; Iron Transport-associated domain (PF05031; HMM-score: 87.5)
    Gram_pos_anchor; LPXTG cell wall anchor motif (PF00746; HMM-score: 37.1)
    DUF5044; Domain of unknown function (DUF5044) (PF16447; HMM-score: 15.3)
    YjbE; Exopolysaccharide production protein YjbE (PF11106; HMM-score: 13)
    post-AAA (CL0604) MgsA_C; MgsA AAA+ ATPase C terminal (PF12002; HMM-score: 6.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 10
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: LPxTG Cell-wall anchored
    • Prediction by SwissProt Classification: Cell Wall
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: found LPxTG motif :LPKTG
  • SignalP: Signal peptide length 47 aa
    • Ymax: 0.618
    • Ymax_pos: 47
    • Cmax: 0.504
    • Cmax_pos: 47
    • Smax: 0.843
    • Smax_pos: 37
    • Smean: 0.598
    • D: 0.61
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKHYLNSKYQSEQRSSAMKKITMGTASIILGSLVYIGADSQQVNAATEATNATNNQSTQVSQATSQPINFQVQKDGSSEKSHMDDYMQHPGKVIKQNNKYYFQTVLNNASFWKEYKFYNANNQELATTVVNDNKKADTRTINVAVEPGYKSLTTKVHIVVPQINYNHRYTTHLEFEKAIPTLADAAKPNNVKPVQPKPAQPKTPTEQTKPVQPKVEKVKPTVTTTSKVEDNHSTKVVSTDTTKDQTKTQTAHTVKTAQTAQEQNKVQTPVKDVATAKSESNNQAVSDNKSQQTNKVTKHNETPKQASKAKELPKTGLTSVDNFISTVAFATLALLGSLSLLLFKRKESK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SA1329 (Fur*)
    Fur* (TF) important in Iron homeostasisRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Simon R Clarke, Michael D Wiltshire, Simon J Foster
IsdA of Staphylococcus aureus is a broad spectrum, iron-regulated adhesin.
Mol. Microbiol.: 2004, 51(5);1509-19
[PubMed:14982642] [WorldCat.org] [DOI] (P p)
Christie L Vermeiren, Mark Pluym, John Mack, David E Heinrichs, Martin J Stillman
Characterization of the heme binding properties of Staphylococcus aureus IsdA.
Biochemistry: 2006, 45(42);12867-75
[PubMed:17042505] [WorldCat.org] [DOI] (P p)
Yukiko K Stranger-Jones, Taeok Bae, Olaf Schneewind
Vaccine assembly from surface proteins of Staphylococcus aureus.
Proc. Natl. Acad. Sci. U.S.A.: 2006, 103(45);16942-7
[PubMed:17075065] [WorldCat.org] [DOI] (P p)
Mark Pluym, Naomi Muryoi, David E Heinrichs, Martin J Stillman
Heme binding in the NEAT domains of IsdA and IsdC of Staphylococcus aureus.
J. Inorg. Biochem.: 2008, 102(3);480-8
[PubMed:18194816] [WorldCat.org] [DOI] (P p)
Jason C Grigg, Cherry X Mao, Michael E P Murphy
Iron-coordinating tyrosine is a key determinant of NEAT domain heme transfer.
J. Mol. Biol.: 2011, 413(3);684-98
[PubMed:21893067] [WorldCat.org] [DOI] (I p)