From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1047 [new locus tag: SA_RS05950 ]
  • pan locus tag?: SAUPAN003484000
  • symbol: pyrF
  • pan gene symbol?: pyrF
  • synonym:
  • product: orotidine 5'-phosphate decarboxylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1047 [new locus tag: SA_RS05950 ]
  • symbol: pyrF
  • product: orotidine 5'-phosphate decarboxylase
  • replicon: chromosome
  • strand: +
  • coordinates: 1186414..1187106
  • length: 693
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAAAGATTTACCAATTATTGCATTAGATTTTGAATCAAAAGAAAAAGTAAATCAATTT
    TTAGATTTATTTGATGAATCATTATTCGTAAAAGTAGGTATGGAACTTTTTTATCAAGAA
    GGTCCTCAATTAATTAATGAGATAAAAGAAAGAGGCCATGATGTATTTTTAGATTTAAAA
    CTGCATGATATTCCTAATACAGTTGGTAAGGCGATGGAAGGACTAGCTAAATTGAATGTT
    GATCTGGTAAATGTTCATGCTGCTGGTGGCGTAAAAATGATGTCTGAGGCCATTAAAGGA
    TTAAGAAAACATAATCAACATACAAAAATTATTGCAGTAACACAGCTTACGTCAACAACA
    GAAGACATGTTACGACACGAACAAAATATACAAACATCGATTGAAGAGGCCGTTTTAAAT
    TATGCCAAGTTAGCAAATGCAGCTGGTTTAGATGGCGTTGTTTGTTCACCTCTTGAAAGT
    CGTATGTTGACTGAAAAGTTAGGTACATCATTTTTAAAAGTAACACCAGGTATTAGACCT
    AAAGGTGCATCTCAAGATGACCAACACCGTATTACGACACCGGAAGAAGCAAGACAGCTT
    GGTTCGACGCATATTGTAGTCGGTAGACCGATTACACAAAGTGACAATCCAGTCGAAAGT
    TATCATAAAATTAAAGAAAGTTGGTTAGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    693

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1047 [new locus tag: SA_RS05950 ]
  • symbol: PyrF
  • description: orotidine 5'-phosphate decarboxylase
  • length: 230
  • theoretical pI: 6.2391
  • theoretical MW: 25619.2
  • GRAVY: -0.292174

Function[edit source | edit]

  • reaction:
    EC 4.1.1.23?  ExPASy
    Orotidine-5'-phosphate decarboxylaseOrotidine 5'-phosphate = UMP + CO2
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisorotidine 5'-phosphate decarboxylase (TIGR01740; EC 4.1.1.23; HMM-score: 207.2)
    3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 22.3)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinesDe Novo Pyrimidine Synthesis Orotidine 5'-phosphate decarboxylase (EC 4.1.1.23) 
  • PFAM:
    TIM_barrel (CL0036) OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 160.3)
    no clan definedDUF3842; Domain of unknown function (DUF3842) (PF12953; HMM-score: 13.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.096
    • Ymax_pos: 46
    • Cmax: 0.102
    • Cmax_pos: 14
    • Smax: 0.107
    • Smax_pos: 70
    • Smean: 0.07
    • D: 0.086
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKDLPIIALDFESKEKVNQFLDLFDESLFVKVGMELFYQEGPQLINEIKERGHDVFLDLKLHDIPNTVGKAMEGLAKLNVDLVNVHAAGGVKMMSEAIKGLRKHNQHTKIIAVTQLTSTTEDMLRHEQNIQTSIEEAVLNYAKLANAAGLDGVVCSPLESRMLTEKLGTSFLKVTPGIRPKGASQDDQHRITTPEEARQLGSTHIVVGRPITQSDNPVESYHKIKESWLV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: PyrR
    PyrR (RNA) important in Pyrimidine metabolism  RegPrecise   binding of the PyrR antitermination protein

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]