From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1063 [new locus tag: SA_RS06030 ]
  • pan locus tag?: SAUPAN003503000
  • symbol: SA1063
  • pan gene symbol?: pknB
  • synonym:
  • product: protein kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1063 [new locus tag: SA_RS06030 ]
  • symbol: SA1063
  • product: protein kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 1202384..1204378
  • length: 1995
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    ATGATAGGTAAAATAATAAATGAACGATATAAAATTGTAGATAAGCTTGGCGGCGGTGGC
    ATGAGTACCGTTTATCTTGCAGAAGATACGATACTTAACATTAAAGTTGCAATTAAGGCG
    ATTTTTATACCACCTAGAGAAAAAGAAGAAACATTAAAACGTTTTGAACGAGAAGTACAT
    AACTCATCACAGCTATCACATCAAAATATAGTAAGTATGATCGATGTTGATGAAGAAGAT
    GACTGTTACTACTTAGTAATGGAATATATTGAAGGTCCGACTTTGTCTGAGTATATTGAA
    AGTCATGGGCCATTAAGTGTTGACACGGCGATTAATTTTACGAATCAAATATTGGATGGC
    ATTAAACATGCGCATGATATGCGTATTGTACATAGAGATATTAAGCCACAAAATATATTA
    ATTGACAGCAATAAAACGTTGAAAATATTTGATTTTGGAATTGCTAAAGCTTTAAGTGAG
    ACGTCTTTAACTCAGACTAATCATGTGTTAGGTACTGTGCAGTACTTTTCGCCAGAACAA
    GCAAAAGGTGAGGCAACGGATGAATGTACAGATATTTATTCTATAGGTATTGTGTTATAT
    GAAATGCTTGTTGGTGAACCACCCTTTAATGGAGAAACTGCAGTTAGCATTGCGATTAAA
    CATATTCAGGATTCTGTGCCAAATGTGACAACAGATGTACGTAAGGATATTCCGCAATCT
    TTAAGTAATGTCATTTTACGCGCTACAGAAAAAGACAAAGCGAATCGTTACAAAACAATT
    CAAGAAATGAAAGATGATTTGAGTAGTGTTTTACATGAAAATCGAGCGAATGAAGATGTC
    TATGAACTCGATAAAATGAAAACGATAGCGGTACCTTTGAAAAAAGAAGATCTAGCAAAG
    CATATTAGTGAACATAAGTCGAATCAACCTAAACGTGAAACGACGCAAGTACCTATTGTA
    AATGGGCCTGCTCATCATCAGCAATTCCAAAAGCCAGAAGGTACGGTGTACGAACCAAAA
    CCTAAAAAGAAATCAACACGAAAGATTGTGCTCTTATCACTAATCTTTTCGTTGTTAATG
    ATTGCACTTGTTTCTTTTGTGGCAATGGCAATGTTTGGTAATAAATACGAAGAGACACCT
    GATGTAATCGGGAAATCTGTAAAAGAAGCAGAGCAAATATTCAATAAAAACAACCTGAAA
    TTGGGTAAAATTTCTAGAAGTTATAGTGATAAATATCCTGAAAATGAAATTATTAAGACA
    ACTCCTAATACTGGTGAACGTGTTGAACGTGGTGACAGTGTTGATGTTGTTATATCAAAG
    GGCCCTGAAAAGGTTAAAATGCCAAATGTCATTGGTTTACCTAAGGAGGAAGCATTGCAG
    AAATTAAAATCGTTAGGTCTTAAAGATGTTACGATTGAAAAAGTATATAATAATCAAGCG
    CCAAAAGGATACATTGCAAATCAAAGTGTAACCGCAAATACTGAAATCGCTATTCATGAT
    TCTAATATTAAACTATATGAATCTTTAGGCATTAAGCAAGTTTATGTAGAAGACTTTGAG
    CATAAATCCTTTAGCAAAGCTAAAAAAGCCTTAGAAGAAAAAGGGTTTAAAGTTGAAAGT
    AAGGAAGAGTATAGTGACGATATTGATGAGGGTGATGTGATTTCTCAATCTCCTAAAGGA
    AAATCAGTAGATGAGGGGTCAACGATTTCATTTGTTGTTTCTAAAGGTAAAAAAAGTGAC
    TCATCAGATGTCAAAACGACAACTGAATCGGTAGATGTACCATACACTGGTAAAAATGAT
    AAGTCACAAAAAGTTAAAGTTTATATTAAAGATAAAGATAATGACGGTTCAACTGAAAAA
    GGTAGTTTCGACATTACTAGTGATCAACGTATAGACATTCCTTTAAGAATTGAAAAAGGA
    AAAACAGCAAGTTATATTGTTAAAGTTGACGGTAAAACTGTAGCTGAAAAAGAAGTCAGC
    TATGATGATATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    1995

Protein[edit source | edit]

Protein Data Bank: 3M9G
Protein Data Bank: 4EQM

General[edit source | edit]

  • locus tag: SA1063 [new locus tag: SA_RS06030 ]
  • symbol: SA1063
  • description: protein kinase
  • length: 664
  • theoretical pI: 5.9417
  • theoretical MW: 74376.9
  • GRAVY: -0.546386

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesToxin production and resistanceTOMM system kinase/cyclase fusion protein (TIGR03903; HMM-score: 150.6)
    Unknown functionGeneralKae1-associated kinase Bud32 (TIGR03724; EC 2.7.-.-; HMM-score: 41.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenylphenol 6-hydroxylase (TIGR01982; EC 1.14.13.-; HMM-score: 16.9)
    early transcribed membrane protein (ETRAMP) family (TIGR01495; HMM-score: 14.5)
  • TheSEED:  
    A Gram-positive cluster that relates ribosomal protein L28P to a set of uncharacterized proteins Serine/threonine protein kinase PrkC, regulator of stationary phase 
    Conserved gene cluster associated with Met-tRNA formyltransferase Serine/threonine protein kinase PrkC, regulator of stationary phase 
  • PFAM:
    PKinase (CL0016) Pkinase; Protein kinase domain (PF00069; HMM-score: 196.3)
    no clan definedPASTA; PASTA domain (PF03793; HMM-score: 145.1)
    PKinase (CL0016) Pkinase_Tyr; Protein tyrosine kinase (PF07714; HMM-score: 134.6)
    APH; Phosphotransferase enzyme family (PF01636; HMM-score: 27)
    Seadorna_VP7; Seadornavirus VP7 (PF07387; HMM-score: 15.7)
    RIO1; RIO1 family (PF01163; HMM-score: 15.2)
    no clan definedSigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 15.2)
    ChlamPMP_M; Chlamydia polymorphic membrane protein middle domain (PF07548; HMM-score: 14.9)
    PKinase (CL0016) Choline_kinase; Choline/ethanolamine kinase (PF01633; HMM-score: 14.7)
    Kinase-like; Kinase-like (PF14531; HMM-score: 13.8)
    no clan definedETRAMP; Malarial early transcribed membrane protein (ETRAMP) (PF09716; HMM-score: 13.4)
    PKinase (CL0016) Kdo; Lipopolysaccharide kinase (Kdo/WaaP) family (PF06293; HMM-score: 12.8)
    no clan definedPNPase; Polyribonucleotide nucleotidyltransferase, RNA binding domain (PF03726; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.116
    • Ymax_pos: 11
    • Cmax: 0.131
    • Cmax_pos: 27
    • Smax: 0.174
    • Smax_pos: 36
    • Smean: 0.133
    • D: 0.123
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MIGKIINERYKIVDKLGGGGMSTVYLAEDTILNIKVAIKAIFIPPREKEETLKRFEREVHNSSQLSHQNIVSMIDVDEEDDCYYLVMEYIEGPTLSEYIESHGPLSVDTAINFTNQILDGIKHAHDMRIVHRDIKPQNILIDSNKTLKIFDFGIAKALSETSLTQTNHVLGTVQYFSPEQAKGEATDECTDIYSIGIVLYEMLVGEPPFNGETAVSIAIKHIQDSVPNVTTDVRKDIPQSLSNVILRATEKDKANRYKTIQEMKDDLSSVLHENRANEDVYELDKMKTIAVPLKKEDLAKHISEHKSNQPKRETTQVPIVNGPAHHQQFQKPEGTVYEPKPKKKSTRKIVLLSLIFSLLMIALVSFVAMAMFGNKYEETPDVIGKSVKEAEQIFNKNNLKLGKISRSYSDKYPENEIIKTTPNTGERVERGDSVDVVISKGPEKVKMPNVIGLPKEEALQKLKSLGLKDVTIEKVYNNQAPKGYIANQSVTANTEIAIHDSNIKLYESLGIKQVYVEDFEHKSFSKAKKALEEKGFKVESKEEYSDDIDEGDVISQSPKGKSVDEGSTISFVVSKGKKSDSSDVKTTTESVDVPYTGKNDKSQKVKVYIKDKDNDGSTEKGSFDITSDQRIDIPLRIEKGKTASYIVKVDGKTVAEKEVSYDDI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)

Relevant publications[edit source | edit]

Patricia Paracuellos, Allison Ballandras, Xavier Robert, Alain J Cozzone, Bertrand Duclos, Patrice Gouet
Crystallization and initial X-ray diffraction study of the three PASTA domains of the Ser/Thr kinase Stk1 from the human pathogen Staphylococcus aureus.
Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun.: 2009, 65(Pt 11);1187-9
[PubMed:19923747] [WorldCat.org] [DOI] (I p)
Patricia Paracuellos, Allison Ballandras, Xavier Robert, Richard Kahn, Mireille Hervé, Dominique Mengin-Lecreulx, Alain J Cozzone, Bertrand Duclos, Patrice Gouet
The extended conformation of the 2.9-Å crystal structure of the three-PASTA domain of a Ser/Thr kinase from the human pathogen Staphylococcus aureus.
J. Mol. Biol.: 2010, 404(5);847-58
[PubMed:20965199] [WorldCat.org] [DOI] (I p)
Sonja Rakette, Stefanie Donat, Knut Ohlsen, Thilo Stehle
Structural analysis of Staphylococcus aureus serine/threonine kinase PknB.
PLoS ONE: 2012, 7(6);e39136
[PubMed:22701750] [WorldCat.org] [DOI] (I p)