From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1080 [new locus tag: SA_RS06120 ]
  • pan locus tag?: SAUPAN003524000
  • symbol: ffh
  • pan gene symbol?: ffh
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1080 [new locus tag: SA_RS06120 ]
  • symbol: ffh
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1222306..1223673
  • length: 1368
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGGCATTTGAAGGCTTATCAGAACGCCTGCAAGCGACGATGCAAAAAATGCGTGGTAAG
    GGTAAACTTACTGAAGCTGATATAAAGATAATGATGCGTGAAGTAAGATTAGCGTTATTT
    GAGGCTGACGTAAACTTTAAAGTGGTAAAAGAATTTATTAAAACAGTATCAGAACGCGCA
    TTAGGTTCCGATGTAATGCAATCATTAACACCAGGGCAACAAGTTATTAAAATAGTTCAA
    GATGAATTAACGAAGTTGATGGGTGGAGAAAATACATCGATTAATATGTCAAATAAACCA
    CCTACTGTTGTTATGATGGTTGGTTTACAAGGTGCTGGTAAAACAACAACTGCAGGTAAA
    TTAGCATTATTGATGCGTAAAAAATACAACAAAAAACCTATGTTAGTTGCAGCAGATATT
    TATCGTCCAGCAGCGATAAATCAATTACAAACAGTAGGGAAACAAATTGATATTCCTGTA
    TACAGTGAAGGAGATCAAGTAAAGCCACAACAAATTGTAACTAATGCATTAAAACATGCT
    AAAGAAGAACATTTAGACTTTGTAATCATTGATACAGCAGGTCGATTACACATCGATGAA
    GCATTGATGAACGAATTAAAAGAAGTAAAAGAAATTGCTAAACCAAACGAAATTATGTTA
    GTTGTCGATTCAATGACGGGTCAAGATGCTGTCAATGTTGCAGAATCTTTTGACGATCAA
    CTTGATGTCACAGGTGTTACCTTAACTAAATTAGATGGTGATACACGTGGTGGTGCAGCT
    TTATCTATTCGTTCGGTGACACAAAAACCAATTAAATTTGTTGGTATGAGTGAAAAGTTA
    GATGGTTTAGAGCTATTCCATCCTGAACGTATGGCATCACGTATTTTAGGTATGGGTGAT
    GTGTTAAGTTTAATTGAAAAAGCGCAACAAGATGTGGATCAAGAAAAAGCAAAAGATTTA
    GAGAAAAAGATGCGTGAGTCATCGTTTACTTTAGATGATTTTTTAGAACAACTTGATCAG
    GTGAAAAATCTAGGACCACTGGATGATATTATGAAAATGATTCCAGGTATGAATAAAATG
    AAAGGGCTAGATAAGCTTAATATGAGTGAAAAGCAAATTGATCATATTAAAGCGATTATC
    CAGTCAATGACGCCGGCTGAAAGAAACAATCCAGACACATTGAATGTATCACGTAAAAAG
    CGTATTGCTAAAGGGTCTGGTCGTTCATTACAAGAAGTCAATCGTTTGATGAAACAATTT
    AACGATATGAAGAAAATGATGAAACAATTCACTGGTGGCGGTAAAGGTAAAAAAGGTAAA
    CGCAATCAAATGCAAAATATGTTAAAAGGTATGAATTTACCGTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1368

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1080 [new locus tag: SA_RS06120 ]
  • symbol: Ffh
  • description: hypothetical protein
  • length: 455
  • theoretical pI: 10.0414
  • theoretical MW: 50753.1
  • GRAVY: -0.417143

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle protein (TIGR00959; HMM-score: 628.3)
    signal recognition particle protein SRP54 (TIGR01425; HMM-score: 307.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 231.2)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 67.8)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 21.3)
    MetabolismEnergy metabolismPhotosynthesisphotosystem II biogenesis protein Psp29 (TIGR03060; HMM-score: 17.1)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 15.7)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.5)
  • TheSEED:  
    Two cell division clusters relating to chromosome partitioning Signal recognition particle protein Ffh 
    Universal GTPases Signal recognition particle protein Ffh 
  • PFAM:
    P-loop_NTPase (CL0023) SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 257.6)
    no clan definedSRP_SPB; Signal peptide binding domain (PF02978; HMM-score: 119.6)
    SRP54_N; SRP54-type protein, helical bundle domain (PF02881; HMM-score: 75.6)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 24.2)
    AAA_17; AAA domain (PF13207; HMM-score: 22.9)
    AAA_31; AAA domain (PF13614; HMM-score: 19.5)
    AAA_33; AAA domain (PF13671; HMM-score: 19.5)
    AAA_22; AAA domain (PF13401; HMM-score: 18.4)
    AAA_30; AAA domain (PF13604; HMM-score: 17.1)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 16.7)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 16.4)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 15.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 14.5)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 14.3)
    6PF2K; 6-phosphofructo-2-kinase (PF01591; HMM-score: 13.7)
    AAA_25; AAA domain (PF13481; HMM-score: 13.3)
    HTH (CL0123) Tn7_Tnp_TnsA_C; TnsA endonuclease C terminal (PF08721; HMM-score: 13.2)
    P-loop_NTPase (CL0023) Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 13)
    ABC_tran; ABC transporter (PF00005; HMM-score: 12.7)
    AAA_24; AAA domain (PF13479; HMM-score: 8.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 7.8)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA2428(arcA)arginine deiminase  [2] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0505(fus)elongation factor G  [2] (data from MRSA252)
    SA0457(glmU)bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [2] (data from MRSA252)
    SA1504(infC)translation initiation factor IF-3  [2] (data from MRSA252)
    SA0451(ksgA)dimethyladenosine transferase  [2] (data from MRSA252)
    SA0038(mecA)penicillin binding protein 2 prime  [2] (data from MRSA252)
    SA1608(metK)S-adenosylmethionine synthetase  [2] (data from MRSA252)
    SA0686(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [2] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [2] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [2] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA0454(purR)pur operon repressor  [2] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2047(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA2036(rplX)50S ribosomal protein L24  [2] (data from MRSA252)
    SA2039(rpmC)50S ribosomal protein L29  [2] (data from MRSA252)
    SA1922(rpmE2)50S ribosomal protein L31  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [2] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [2] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [2] (data from MRSA252)
    SA1116(rpsO)30S ribosomal protein S15  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA0708(secA)preprotein translocase subunit SecA  [2] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [2] (data from MRSA252)
    SA0592(tagA)teichoic acid biosynthesis protein  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA0182hypothetical protein  [2] (data from MRSA252)
    SA0295hypothetical protein  [2] (data from MRSA252)
    SA0627hypothetical protein  [2] (data from MRSA252)
    SA0637hypothetical protein  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA0940hypothetical protein  [2] (data from MRSA252)
    SA1118hypothetical protein  [2] (data from MRSA252)
    SA1423hypothetical protein  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1885hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.122
    • Ymax_pos: 20
    • Cmax: 0.111
    • Cmax_pos: 20
    • Smax: 0.156
    • Smax_pos: 10
    • Smean: 0.117
    • D: 0.12
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15926820 NCBI
  • RefSeq: NP_374353 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAFEGLSERLQATMQKMRGKGKLTEADIKIMMREVRLALFEADVNFKVVKEFIKTVSERALGSDVMQSLTPGQQVIKIVQDELTKLMGGENTSINMSNKPPTVVMMVGLQGAGKTTTAGKLALLMRKKYNKKPMLVAADIYRPAAINQLQTVGKQIDIPVYSEGDQVKPQQIVTNALKHAKEEHLDFVIIDTAGRLHIDEALMNELKEVKEIAKPNEIMLVVDSMTGQDAVNVAESFDDQLDVTGVTLTKLDGDTRGGAALSIRSVTQKPIKFVGMSEKLDGLELFHPERMASRILGMGDVLSLIEKAQQDVDQEKAKDLEKKMRESSFTLDDFLEQLDQVKNLGPLDDIMKMIPGMNKMKGLDKLNMSEKQIDHIKAIIQSMTPAERNNPDTLNVSRKKRIAKGSGRSLQEVNRLMKQFNDMKKMMKQFTGGGKGKKGKRNQMQNMLKGMNLPF

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]