From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1346 [new locus tag: SA_RS07630 ]
  • pan locus tag?: SAUPAN004070000
  • symbol: bmfBB
  • pan gene symbol?: bmfBB
  • synonym:
  • product: branched-chain alpha-keto acid dehydrogenase E2 subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1346 [new locus tag: SA_RS07630 ]
  • symbol: bmfBB
  • product: branched-chain alpha-keto acid dehydrogenase E2 subunit
  • replicon: chromosome
  • strand: -
  • coordinates: 1555520..1556794
  • length: 1275
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGGAAATAACAATGCCTAAGTTAGGTGAGAGTGTTCATGAAGGTACCATTGAACAATGG
    TTAGTTTCTGTTGGTGATCATATTGATGAATATGAACCATTATGTGAAGTTATTACAGAT
    AAAGTGACAGCTGAAGTCCCTTCCACGATATCAGGAACAATTACAGAAATTTTAGTTGAA
    GCGGGGCAGACAGTAGCTATTGATACAATTATCTGTAAAATTGAAACTGCTGATGAAAAG
    ACAAATGAAACAACTGAAGAGATACAAGCAAAAGTGGATGAGCATACTCAGAAATCTACT
    AAAAAAGCTAGTGCAACAGTGGAACAGACATTTACTGCTAAACAAAATCAACCTCGTAAT
    AATGGTCGCTTTTCACCTGTTGTATTTAAACTCGCTTCAGAGCATGACATTGATTTATCA
    CAAGTTGTAGGTAGTGGATTTGAAGGTCGTGTAACTAAGAAGGATATAATGTCAGTTATT
    GAAAATGGTGGTACCACAGCTCAATCTGACAAACAAGTTCAAACAAAATCAACATCAGTA
    GATACATCAAGTAACCAATCATCTGAAGACAATAGTGAAAACAGCACAATACCAGTAAAT
    GGTGTGCGTAAAGCAATTGCGCAAAATATGGTTAATAGTGTAACAGAGATTCCACATGCA
    TGGATGATGATTGAAGTAGATGCTACAAATCTTGTGAATACGAGAAATCATTATAAAAAC
    AGCTTTAAAAATAAAGAAGGATATAATCTAACGTTCTTTGCTTTCTTTGTAAAAGCTGTA
    GCAGATGCTTTAAAAGCATATCCTTTATTAAATAGTAGCTGGCAAGGAAATGAAATTGTC
    TTACATAAAGACATTAATATTTCAATTGCTGTTGCTGATGAAAATAAATTATACGTACCT
    GTGATTAAGCATGCAGACGAAAAGTCAATCAAAGGTATAGCTAGAGAAATTAATACTTTA
    GCAACAAAAGCGCGTAATAAGCAATTGACAACTGAAGATATGCAAGGTGGAACATTTACA
    GTTAATAATACTGGTACATTTGGTTCAGTATCATCAATGGGGATTATAAATCACCCTCAA
    GCAGCGATATTACAAGTAGAATCAATCGTTAAAAAGCCAGTAGTAATTAATGATATGATT
    GCAATTCGAAGTATGGTAAATTTATGTATTTCAATAGATCATCGCATTTTAGATGGTTTA
    CAAACTGGTAAATTTATGAATCATATTAAACAGCGTATCGAACAGTATACTTTAGAAAAT
    ACAAATATATATTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1275

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1346 [new locus tag: SA_RS07630 ]
  • symbol: BmfBB
  • description: branched-chain alpha-keto acid dehydrogenase E2 subunit
  • length: 424
  • theoretical pI: 5.3171
  • theoretical MW: 46788.5
  • GRAVY: -0.330425

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase (TIGR02927; EC 2.3.1.61; HMM-score: 333.3)
    MetabolismEnergy metabolismTCA cycledihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (TIGR01347; EC 2.3.1.61; HMM-score: 317)
    MetabolismEnergy metabolismPyruvate dehydrogenasepyruvate dehydrogenase complex dihydrolipoamide acetyltransferase (TIGR01349; EC 2.3.1.12; HMM-score: 275.9)
    MetabolismEnergy metabolismPyruvate dehydrogenasedihydrolipoyllysine-residue acetyltransferase (TIGR01348; EC 2.3.1.12; HMM-score: 249.2)
    MetabolismTransport and binding proteinsUnknown substrateefflux transporter, RND family, MFP subunit (TIGR01730; HMM-score: 20.1)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxyl carrier protein (TIGR00531; HMM-score: 19.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsoxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 14.6)
    MetabolismEnergy metabolismOtheroxaloacetate decarboxylase alpha subunit (TIGR01108; EC 4.1.1.3; HMM-score: 14.6)
    putative heme-binding domain (TIGR02603; HMM-score: 9.1)
  • TheSEED:  
    Amino Acids and DerivativesBranched-chain amino acidsIsoleucine degradation Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) 
    Branched-chain amino acidsValine degradation Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) 
    CarbohydratesCentral carbohydrate metabolismDehydrogenase complexes Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) 
    Cofactors, Vitamins, Prosthetic Groups, PigmentsLipoic acidLipoic acid metabolism Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168) 
  • PFAM:
    CoA-acyltrans (CL0149) 2-oxoacid_dh; 2-oxoacid dehydrogenases acyltransferase (catalytic domain) (PF00198; HMM-score: 270)
    Hybrid (CL0105) Biotin_lipoyl; Biotin-requiring enzyme (PF00364; HMM-score: 80.3)
    no clan definedE3_binding; e3 binding domain (PF02817; HMM-score: 42)
    Hybrid (CL0105) Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 22.4)
    HlyD_3; HlyD family secretion protein (PF13437; HMM-score: 16.4)
    GCV_H; Glycine cleavage H-protein (PF01597; HMM-score: 14.9)
    no clan definedGP70; Gene 70 protein (PF17429; HMM-score: 12)
    DUF2155; Uncharacterized protein conserved in bacteria (DUF2155) (PF09923; HMM-score: 9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.099
    • Ymax_pos: 68
    • Cmax: 0.119
    • Cmax_pos: 68
    • Smax: 0.115
    • Smax_pos: 25
    • Smean: 0.069
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15927096 NCBI
  • RefSeq: NP_374629 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MEITMPKLGESVHEGTIEQWLVSVGDHIDEYEPLCEVITDKVTAEVPSTISGTITEILVEAGQTVAIDTIICKIETADEKTNETTEEIQAKVDEHTQKSTKKASATVEQTFTAKQNQPRNNGRFSPVVFKLASEHDIDLSQVVGSGFEGRVTKKDIMSVIENGGTTAQSDKQVQTKSTSVDTSSNQSSEDNSENSTIPVNGVRKAIAQNMVNSVTEIPHAWMMIEVDATNLVNTRNHYKNSFKNKEGYNLTFFAFFVKAVADALKAYPLLNSSWQGNEIVLHKDINISIAVADENKLYVPVIKHADEKSIKGIAREINTLATKARNKQLTTEDMQGGTFTVNNTGTFGSVSSMGIINHPQAAILQVESIVKKPVVINDMIAIRSMVNLCISIDHRILDGLQTGKFMNHIKQRIEQYTLENTNIY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)

Relevant publications[edit source | edit]