From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1821 [new locus tag: SA_RS10455 ]
  • pan locus tag?: SAUPAN005219000
  • symbol: SA1821
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1821 [new locus tag: SA_RS10455 ]
  • symbol: SA1821
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2062501..2062842
  • length: 342
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    ATGGATAAAAAGCAAATAAAAGACTTCGTTTGTGATTATCATAAGCGAACTATAAGTGAT
    GTGTTGATAGATGATGAAATAAATACCGATGAATTCTTTTCAATAGGTGATGAAAATTCT
    AATGAATGGATGGCAGACGATAACATTGATGATCATATTGTAAAGAATCACTTAGAAATG
    ATTGTTGACCAAGTAGCTAATGATAAAGAGTTTTATATTTTCGATTCTTTAATACAAGGA
    CGTAGTTTTAAAGATATTAGCAATGTCTTAGAGTGTTCAGAACAATCTGTAAGATTATGG
    TATGAAACCTTATTAGATAAAATTGTGGAGGTGATAGAATGA
    60
    120
    180
    240
    300
    342

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1821 [new locus tag: SA_RS10455 ]
  • symbol: SA1821
  • description: hypothetical protein
  • length: 113
  • theoretical pI: 3.9958
  • theoretical MW: 13367.8
  • GRAVY: -0.458407

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 19.6)
    3'(2'),5'-bisphosphate nucleotidase (TIGR01330; EC 3.1.3.7; HMM-score: 15.5)
  • TheSEED:  
    Phages, Prophages, Transposable elements, PlasmidsPathogenicity islandsStaphylococcal pathogenicity islands SaPI Hypothetical SAV0799 homolog in superantigen-encoding pathogenicity islands SaPI 
  • PFAM:
    HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 19.7)
    Phage_terminase; Phage terminase small subunit (PF10668; HMM-score: 17.9)
    HTH_Tnp_ISL3; Helix-turn-helix domain of transposase family ISL3 (PF13542; HMM-score: 13.9)
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 13.5)
    PDDEXK (CL0236) NgoMIV_restric; NgoMIV restriction enzyme (PF09015; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.098
    • Ymax_pos: 11
    • Cmax: 0.124
    • Cmax_pos: 46
    • Smax: 0.15
    • Smax_pos: 4
    • Smean: 0.104
    • D: 0.1
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDKKQIKDFVCDYHKRTISDVLIDDEINTDEFFSIGDENSNEWMADDNIDDHIVKNHLEMIVDQVANDKEFYIFDSLIQGRSFKDISNVLECSEQSVRLWYETLLDKIVEVIE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]