From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1915 [new locus tag: SA_RS11015 ]
  • pan locus tag?: SAUPAN005404000
  • symbol: glyA
  • pan gene symbol?: glyA
  • synonym:
  • product: serine hydroxymethyltransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1915 [new locus tag: SA_RS11015 ]
  • symbol: glyA
  • product: serine hydroxymethyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 2164050..2165288
  • length: 1239
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGTCTTATATCACCAAGCAAGATAAAGTTATCGCAGAAGCAATCGAGAGAGAATTTCAG
    AGACAAAATAGCAACATAGAGTTAATCGCATCGGAAAATTTTGTATCGGAAGCGGTTATG
    GAAGCACAAGGTTCAGTGTTGACTAATAAGTATGCTGAAGGCTATCCAGGACGCCGATAT
    TATGGTGGATGTGAGTTTGTAGATGTTACTGAAAGCATCGCAATTGATCGTGCTAAAGCA
    TTGTTTGGAGCTGAACATGTCAATGTTCAACCACATTCAGGTTCACAAGCGAACATGGCT
    GTTTACTTAGTTGCATTAGAAATGGGCGACACAGTTTTAGGTATGAATTTGAGTCATGGT
    GGTCACTTGACACATGGAGCGCCTGTTAATTTTAGTGGTAAATTCTACAATTTCGTTGAA
    TATGGAGTAGATAAAGACACAGAACGAATCAATTATGATGAAGTTCGTAAATTAGCGTTA
    GAGCATAAGCCTAAGCTTATTGTGGCAGGAGCATCAGCATATTCAAGAACAATTGACTTC
    AAAAAGTTTAAAGAAATCGCAGATGAAGTAAACGCTAAGTTAATGGTAGACATGGCACAT
    ATTGCAGGATTAGTAGCGGCAGGTTTACATCCAAATCCAGTAGAATATGCTGATTTTGTA
    ACAACTACAACACACAAAACATTACGCGGACCACGTGGTGGTATGATTTTATGTAAGGAA
    GAATATAAAAAAGACATAGATAAAACAATTTTCCCTGGTATTCAAGGTGGACCTCTTGAG
    CATGTTATTGCAGCAAAAGCAGTTGCTTTTGGAGAAGCGTTAGAAAATAATTTCAAAACG
    TATCAACAACAAGTGGTTAAAAACGCAAAAGTTCTTGCAGAAGCATTAATTAATGAAGGA
    TTTAGAATTGTTTCTGGCGGTACAGATAATCACTTAGTAGCTGTTGATGTAAAAGGGTCT
    ATAGGACTTACTGGTAAAGAAGCTGAAGAGACTTTAGATTCAGTTGGTATCACATGTAAC
    AAAAATACCATTCCGTTCGATCAAGAAAAACCTTTTGTAACGAGTGGTATACGTTTAGGT
    ACACCTGCTGCAACAACGCGTGGATTTGATGAAAAAGCTTTTGAGGAAGTTGCAAAAATC
    ATCAGTTTAGCATTGAAAAATAGTAAAGATGAAGAAAAATTACAACAAGCTAAAGAACGC
    GTTGCGAAATTAACAGCTGAATATCCTCTATATCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1239

Protein[edit source | edit]

Protein Data Bank: 3PGY

General[edit source | edit]

  • locus tag: SA1915 [new locus tag: SA_RS11015 ]
  • symbol: GlyA
  • description: serine hydroxymethyltransferase
  • length: 412
  • theoretical pI: 5.99288
  • theoretical MW: 45172
  • GRAVY: -0.269417

Function[edit source | edit]

  • reaction:
    EC 2.1.2.1?  ExPASy
    Glycine hydroxymethyltransferase5,10-methylenetetrahydrofolate + glycine + H2O = tetrahydrofolate + L-serine
  • TIGRFAM:
    Cellular processesCellular processesBiosynthesis of natural productsfluorothreonine transaldolase (TIGR04506; EC 2.2.1.8; HMM-score: 114.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotin8-amino-7-oxononanoate synthase (TIGR00858; EC 2.3.1.47; HMM-score: 26.8)
    Unknown functionEnzymes of unknown specificitycysteine desulfurase family protein (TIGR01977; HMM-score: 22.3)
    Unknown functionEnzymes of unknown specificitypyridoxal phosphate enzyme, MJ0158 family (TIGR03576; HMM-score: 20)
    MetabolismEnergy metabolismAmino acids and aminesglycine C-acetyltransferase (TIGR01822; EC 2.3.1.29; HMM-score: 18.8)
    UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase (TIGR03588; EC 2.6.1.92; HMM-score: 16.6)
    dTDP-4-dehydro-6-deoxyglucose aminotransferase (TIGR04427; EC 2.-.-.-; HMM-score: 14.1)
    putative methanogenesis marker protein 8 (TIGR03275; HMM-score: 12.8)
  • TheSEED:  
    Amino Acids and DerivativesAlanine, serine, and glycineGlycine and Serine Utilization Serine hydroxymethyltransferase (EC 2.1.2.1) 
    Alanine, serine, and glycineGlycine Biosynthesis Serine hydroxymethyltransferase (EC 2.1.2.1) 
    Alanine, serine, and glycineGlycine cleavage system Serine hydroxymethyltransferase (EC 2.1.2.1) 
    Alanine, serine, and glycineSerine Biosynthesis Serine hydroxymethyltransferase (EC 2.1.2.1) 
    CarbohydratesOne-carbon MetabolismSerine-glyoxylate cycle Serine hydroxymethyltransferase (EC 2.1.2.1) 
    Cofactors, Vitamins, Prosthetic Groups, PigmentsFolate and pterinesFolate Biosynthesis Serine hydroxymethyltransferase (EC 2.1.2.1) 
    Stress ResponseStress Response - no subcategoryFlavohaemoglobin Serine hydroxymethyltransferase (EC 2.1.2.1) 
    LMPTP YwlE cluster Serine hydroxymethyltransferase (EC 2.1.2.1) 
  • PFAM:
    PLP_aminotran (CL0061) SHMT; Serine hydroxymethyltransferase (PF00464; HMM-score: 599.8)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 31.1)
    Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 25.1)
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 16.6)
    Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 14.2)
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 13)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [2] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA0223hypothetical protein  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.128
    • Ymax_pos: 53
    • Cmax: 0.132
    • Cmax_pos: 53
    • Smax: 0.158
    • Smax_pos: 51
    • Smean: 0.091
    • D: 0.114
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSYITKQDKVIAEAIEREFQRQNSNIELIASENFVSEAVMEAQGSVLTNKYAEGYPGRRYYGGCEFVDVTESIAIDRAKALFGAEHVNVQPHSGSQANMAVYLVALEMGDTVLGMNLSHGGHLTHGAPVNFSGKFYNFVEYGVDKDTERINYDEVRKLALEHKPKLIVAGASAYSRTIDFKKFKEIADEVNAKLMVDMAHIAGLVAAGLHPNPVEYADFVTTTTHKTLRGPRGGMILCKEEYKKDIDKTIFPGIQGGPLEHVIAAKAVAFGEALENNFKTYQQQVVKNAKVLAEALINEGFRIVSGGTDNHLVAVDVKGSIGLTGKEAEETLDSVGITCNKNTIPFDQEKPFVTSGIRLGTPAATTRGFDEKAFEEVAKIISLALKNSKDEEKLQQAKERVAKLTAEYPLYQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 2.0 2.1 2.2 2.3 2.4 2.5

Relevant publications[edit source | edit]