From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1969 [new locus tag: SA_RS11345 ]
  • pan locus tag?: SAUPAN005553000
  • symbol: SA1969
  • pan gene symbol?: salA
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1969 [new locus tag: SA_RS11345 ]
  • symbol: SA1969
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2236331..2237395
  • length: 1065
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    TTGTTAACGGTAGATCAAGTGAAAGAATTGGTAGGAGAAATTAAAGATCCTATTATAGAT
    GTGCCTTTAAAAGAAACAGAAGGTATTGTTGAAGTTTCTATTAAGGAAGAAAAAGAACAT
    GTGAGTGTTAAATTAGCAATGGCACAATTAGGTGGTGCACCGCAATTAGATTTACAGATG
    GCTGTTGTTAATGCATTAAAAGAAAACGGTGCGAAAACGGTCGGTATACGATTTGAAACA
    TTGCCGGAAGAAAAAGTAAATCAATTTAAACCAAAAGAAGAAAATAAACCTAAAACGATA
    GAAGGCCTATTATCTCAAAATAATCCAGTCGAATTTATTGCAATAGCCTCCGGTAAAGGT
    GGTGTCGGTAAATCTACTGTTGCAGTAAATTTAGCCGTTGCCTTAGCTCGTGAAGGGAAA
    AAAGTCGGATTAGTAGATGCCGATATATATGGATTTAGTGTACCAGATATGATGGGTATT
    GATGAAAAGCCTGGAATTAAAGGGAAGGAAGTAATTCCAGTTGAACGTCATGGCGTTAAA
    GTTATATCAATGGCCTTTTTTGTGGAAGAAAATGCGCCAGTTATATGGAGAGGGCCAATG
    TTAGGTAAAATGTTGACGAATTTCTTTACAGAAGTTAAATGGGGAGACATTGAATATTTA
    ATACTCGATCTTCCACCTGGAACAGGAGATGTAGCTTTAGATGTTCATACGATGTTACCT
    TCAAGTAAGGAAATTATTGTAACGACACCTCATCCTACAGCAGCATTTGTTGCAGCTCGC
    GCAGGTGCGATGGCAAAACATACGGATCATTCTATTCTTGGCGTAATTGAAAACATGAGT
    TATTTTGAAAGTAAAGAGACGGGTAATAAAGAATATGTCTTTGGCAAAGGTGGCGGTACT
    AAGTTAGCTGATGAACTTAATACTCAATTACTTGGGGAATTACCTTTAGAGCAACCATCT
    TGGAATCCAAAAGATTTTGCACCGTCAATATATCAATCAGATGATCGTCTAGGTAAAATT
    TATAGCTCGATTGCACAAAAAGTTATAGCTGCTACAAATAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1065

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1969 [new locus tag: SA_RS11345 ]
  • symbol: SA1969
  • description: hypothetical protein
  • length: 354
  • theoretical pI: 5.069
  • theoretical MW: 38358
  • GRAVY: -0.121751

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    cell division ATPase MinD (TIGR01969; HMM-score: 69.8)
    Cellular processesCellular processesCell divisionseptum site-determining protein MinD (TIGR01968; HMM-score: 51.2)
    helicase/secretion neighborhood CpaE-like protein (TIGR03815; HMM-score: 44.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidscapsular exopolysaccharide family (TIGR01007; HMM-score: 36.8)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 35.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidescellulose synthase operon protein YhjQ (TIGR03371; HMM-score: 29.9)
    arsenical pump-driving ATPase (TIGR04291; EC 3.6.1.-; HMM-score: 28.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphylllight-independent protochlorophyllide reductase, iron-sulfur ATP-binding protein (TIGR01281; EC 1.3.7.7; HMM-score: 27.8)
    Hypothetical proteinsConservedtransport-energizing ATPase, TRC40/GET3/ArsA family (TIGR00345; EC 3.6.1.-; HMM-score: 25.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsexopolysaccharide transport protein family (TIGR01005; HMM-score: 25.7)
    MetabolismCentral intermediary metabolismNitrogen fixationnitrogenase iron protein (TIGR01287; EC 1.18.6.1; HMM-score: 23.8)
    chain length determinant protein tyrosine kinase EpsG (TIGR03029; HMM-score: 21.5)
    Genetic information processingMobile and extrachromosomal element functionsPlasmid functionsplasmid partitioning protein RepA (TIGR03453; HMM-score: 17.9)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 16.4)
    MetabolismEnergy metabolismPhotosynthesischlorophyllide reductase iron protein subunit X (TIGR02016; HMM-score: 16.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 15.9)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 15.9)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingsignal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 14.1)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminputative heme d1 biosynthesis radical SAM protein NirJ2 (TIGR04055; EC 1.3.99.-; HMM-score: 12.6)
  • TheSEED:  
    Scaffold protein for [4Fe-4S] cluster assembly ApbC, MRP-like 
  • PFAM:
    P-loop_NTPase (CL0023) ParA; NUBPL iron-transfer P-loop NTPase (PF10609; HMM-score: 289.2)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 52.5)
    AAA_31; AAA domain (PF13614; HMM-score: 45.2)
    MipZ; ATPase MipZ (PF09140; HMM-score: 32.1)
    ArsA_ATPase; Anion-transporting ATPase (PF02374; HMM-score: 27.2)
    Fer4_NifH; 4Fe-4S iron sulfur cluster binding proteins, NifH/frxC family (PF00142; HMM-score: 27.2)
    AAA_25; AAA domain (PF13481; HMM-score: 21.3)
    VirC1; VirC1 protein (PF07015; HMM-score: 20.4)
    CLP1_P; mRNA cleavage and polyadenylation factor CLP1 P-loop (PF16575; HMM-score: 18.8)
    CBP_BcsQ; Cellulose biosynthesis protein BcsQ (PF06564; HMM-score: 18.1)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 16.4)
    ArgK; ArgK protein (PF03308; HMM-score: 15.1)
    APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 13.4)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.6)
    no clan definedPilZ; PilZ domain (PF07238; HMM-score: 12.6)
    P-loop_NTPase (CL0023) KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 12.1)
    PhoH; PhoH-like protein (PF02562; HMM-score: 11.9)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 11.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.11
    • Ymax_pos: 68
    • Cmax: 0.116
    • Cmax_pos: 49
    • Smax: 0.135
    • Smax_pos: 59
    • Smean: 0.085
    • D: 0.1
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLTVDQVKELVGEIKDPIIDVPLKETEGIVEVSIKEEKEHVSVKLAMAQLGGAPQLDLQMAVVNALKENGAKTVGIRFETLPEEKVNQFKPKEENKPKTIEGLLSQNNPVEFIAIASGKGGVGKSTVAVNLAVALAREGKKVGLVDADIYGFSVPDMMGIDEKPGIKGKEVIPVERHGVKVISMAFFVEENAPVIWRGPMLGKMLTNFFTEVKWGDIEYLILDLPPGTGDVALDVHTMLPSSKEIIVTTPHPTAAFVAARAGAMAKHTDHSILGVIENMSYFESKETGNKEYVFGKGGGTKLADELNTQLLGELPLEQPSWNPKDFAPSIYQSDDRLGKIYSSIAQKVIAATNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]