From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2139 [new locus tag: SA_RS12285 ]
  • pan locus tag?: SAUPAN005848000
  • symbol: SA2139
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA2139 [new locus tag: SA_RS12285 ]
  • symbol: SA2139
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2404078..2404497
  • length: 420
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGACAGATGCATTACAACAAAAGATTCATATTGAATTACTAGATTTATTAGATGATGTT
    AAGTTTGAATTAACAGAATTAAATGCACAAAAAGGGTTATACATTAACGGACCAGCAAAT
    CAGCTACTTAAGCGTGGCGTTCATATGGCTTATGTTCAAGGACAAAAGCAAGCCATCGAT
    AATATTATGACTATTGTGGAACAGCAGCTTGAAGATCAACATTTCCTAGAAGATTATGAT
    AAATTTCAAAATGAGGTTACTCATCGCAATTATGATAAAACAGCTAACTTTGCAGAACTT
    AGTGATATTCCACGTCAATTCGATAATTTTTTAGATCAATTTTATCAAATTAAAGGGCAA
    TACTTTATCATCACACATATCAATACACTTATTGGTGATTTTCACTCAGAAGCTCATTAA
    60
    120
    180
    240
    300
    360
    420

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA2139 [new locus tag: SA_RS12285 ]
  • symbol: SA2139
  • description: hypothetical protein
  • length: 139
  • theoretical pI: 4.64048
  • theoretical MW: 16314.2
  • GRAVY: -0.508633

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    formate dehydrogenase, alpha subunit (TIGR01591; EC 1.2.1.2; HMM-score: 10.7)
  • TheSEED:  
    FIG01107838: hypothetical protein 
  • PFAM:
    no clan definedLMP; LMP repeated region (PF04778; HMM-score: 14.4)
    TRAF (CL0389) AvrL567-A; Melampsora lini avirulence protein AvrL567-A (PF11529; HMM-score: 13.9)
    no clan definedDUF3567; Protein of unknown function (DUF3567) (PF12091; HMM-score: 13.8)
    PRP9_N; Pre-mRNA-splicing factor PRP9 N-terminus (PF16958; HMM-score: 13.6)
    COOH-NH2_lig; Phage phiEco32-like COOH.NH2 ligase-type 2 (PF14395; HMM-score: 13)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.097
    • Ymax_pos: 33
    • Cmax: 0.104
    • Cmax_pos: 23
    • Smax: 0.128
    • Smax_pos: 28
    • Smean: 0.073
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTDALQQKIHIELLDLLDDVKFELTELNAQKGLYINGPANQLLKRGVHMAYVQGQKQAIDNIMTIVEQQLEDQHFLEDYDKFQNEVTHRNYDKTANFAELSDIPRQFDNFLDQFYQIKGQYFIITHINTLIGDFHSEAH

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]