From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0252 [new locus tag: SACOL_RS01280 ]
  • pan locus tag?: SAUPAN001152000
  • symbol: SACOL0252
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0252 [new locus tag: SACOL_RS01280 ]
  • symbol: SACOL0252
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 292809..293570
  • length: 762
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAAAGAAGCTGGTCATACATTTTTAGCTAAATTAGGAAAAACTCGTCTACGCCCC
    GGTGGTAAAGAAGCAACAGATTGGTTAATACAACAAGGGGCATTTTCACAAGATAAACAA
    GTGTTAGAAGTGGCATGTAATATGTGCACAACATCTATTTATCTAGCTCATACATATGGC
    TGTCACATTCAAGGCGTTGATATAAATAAGAAAGCATTAGAAAAAGCACAGGAAAACATT
    TCAGCAGCAGGTCTTGAATCATATATTCAAGTTCAACAAGCGAATGCTGTTAAATTGCCC
    TTTGATGACAATCAATTCGATATCGTTTTAAATGAAGCAATGTTAACAATGTTACCCATC
    GCCATAAAGGAAAAAGCATTACGCGAGTACTACCGAGTCTTAAAGCCTGGGGGTATCTTG
    TTAACACATGATATTGTCATCGTTAATGAATCACATGCCACACATGTTGTTAAATCATTA
    TCTGCAGCAATTAATGTCAATGTCTCACCGCAGACGAAACTTGGCTGGTTAGATTTATAT
    AATCAAGCTGGTTTTAATCATGTGCATTATCATACTGGTCCAATGAGTTTAATGACACCA
    AAAGGTTTAATTTATGACGAAGGTATTGTTGGAACTATAAAGATTATCAACAATGCTTTG
    AAAAAAGAAAATCGACCAATGTTTTGTAAAATGTTTAAAACGATGACTAAATTGCGTAAA
    GATATGAATTATATTACTTTTGTCGCTAAAAAAGAGCACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    762

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0252 [new locus tag: SACOL_RS01280 ]
  • symbol: SACOL0252
  • description: hypothetical protein
  • length: 253
  • theoretical pI: 9.42825
  • theoretical MW: 28346.8
  • GRAVY: -0.183399

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 58.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinonedemethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 48.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 32.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinmalonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 31.6)
    pseudaminic acid biosynthesis-associated methylase (TIGR03587; HMM-score: 23.9)
    Genetic information processingProtein fateProtein modification and repairmethyltransferase, HemK family (TIGR00536; HMM-score: 23.6)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationprotein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 22.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersGlutathione and analogsputative 4-mercaptohistidine N1-methyltranferase (TIGR04345; HMM-score: 21.9)
    Genetic information processingProtein fateProtein modification and repairprotein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 21.6)
    methyltransferase, Rta_06860 family (TIGR04290; EC 2.1.1.-; HMM-score: 19)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 18.5)
    Genetic information processingProtein synthesisRibosomal proteins: synthesis and modificationribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 18.3)
    Unknown functionEnzymes of unknown specificitytRNA (cmo5U34)-methyltransferase (TIGR00740; EC 2.1.1.-; HMM-score: 16.5)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 13.5)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 13.4)
    Unknown functionEnzymes of unknown specificityputative methylase (TIGR00537; HMM-score: 12.4)
  • TheSEED:  
    2-heptaprenyl-1,4-naphthoquinone methyltransferase (EC 2.1.1.163) 
    2-methoxy-6-polyprenyl-1,4-benzoquinol methylase (EC 2.1.1.201) 
  • PFAM:
    NADP_Rossmann (CL0063) Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 71.6)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 70.5)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 66.5)
    Ubie_methyltran; ubiE/COQ5 methyltransferase family (PF01209; HMM-score: 55.2)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 40.8)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 39.1)
    CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 34.6)
    UPF0020; Putative RNA methylase family UPF0020 (PF01170; HMM-score: 30.1)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 26.5)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 26.1)
    PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 23)
    CheR; CheR methyltransferase, SAM binding domain (PF01739; HMM-score: 19.5)
    Methyltransf_8; Hypothetical methyltransferase (PF05148; HMM-score: 18.4)
    Methyltransf_24; Methyltransferase domain (PF13578; HMM-score: 17.5)
    TrmK; tRNA (adenine(22)-N(1))-methyltransferase (PF04816; HMM-score: 15.4)
    TPMT; Thiopurine S-methyltransferase (TPMT) (PF05724; HMM-score: 13.5)
    ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 12.9)
    Methyltransf_10; Protein of unknown function (DUF890) (PF05971; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.162
    • Ymax_pos: 11
    • Cmax: 0.166
    • Cmax_pos: 37
    • Smax: 0.34
    • Smax_pos: 4
    • Smean: 0.253
    • D: 0.198
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSKEAGHTFLAKLGKTRLRPGGKEATDWLIQQGAFSQDKQVLEVACNMCTTSIYLAHTYGCHIQGVDINKKALEKAQENISAAGLESYIQVQQANAVKLPFDDNQFDIVLNEAMLTMLPIAIKEKALREYYRVLKPGGILLTHDIVIVNESHATHVVKSLSAAINVNVSPQTKLGWLDLYNQAGFNHVHYHTGPMSLMTPKGLIYDEGIVGTIKIINNALKKENRPMFCKMFKTMTKLRKDMNYITFVAKKEH

Experimental data[edit source | edit]

  • experimental localization: Cytoplasmic [1]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]