From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0570
  • pan locus tag?: SAUPAN002290000
  • symbol: clpC
  • pan gene symbol?: clpC
  • synonym:
  • product:

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: pseudogene
  • locus tag: SACOL0570
  • symbol: clpC
  • product:
  • replicon: chromosome
  • strand: +
  • coordinates: 590053..592508
  • length: 2456
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    ATGTTATTTGGTAGATTAACTGAGCGTGCACAGCGCGTATTAGCACATGCCCAAGAAGAA
    GCAATTCGTTTAAATCATTCAAATATAGGAACAGAACACCTATTATTGGGGTTAATGAAA
    GAACCTGAAGGAATTGCTGCAAAAGTATTAGAAAGTTTTAATATCACTGAAGATAAAGTA
    ATTGAAGAAGTTGAAAAATTAATCGGACATGGTCAAGATCATGTTGGTACATTGCATTAT
    ACACCTAGAGCTAAAAAAGTCATTGAATTATCGATGGATGAAGCTAGAAAATTACATCAC
    AATTTTGTTGGAACGGAACATATTTTATTAGGCTTGATTCGTGAAAATGAAGGTGTTGCA
    GCAAGAGTTTTTGCAAATCTAGATTTAAATATTACTAAAGCACGTGCACAAGTTGTGAAA
    GCTTTAGGAAACCCTGAAATGAGTAATAAAAATGCACAAGCTAGTAAGTCAAATAATACT
    CCAACTTTAGATAGTTTAGCTCGTGACTTAACAGTCATTGCCAAAGACGGTACATTAGAT
    CCTGTTATAGGACGTGATAAAGAAATTACACGTGTAATTGAAGTATTAAGTAGACGTACG
    AAAAACAATCCTGTGCTTATTGGAGAGCCAGGTGTTGGTAAAACTGCTATTGCTGAAGGT
    TTAGCGCAAGCCATAGTGAATAATGAGGTACCAGAGACATTAAAAGATAAGCGTGTTATG
    TCTTTAGATATGGGAACAGTAGTTGCAGGTACTAAATATCGTGGTGAATTTGAAGAGCGT
    CTGAAAAAGGTTATGGAAGAAATCCAACAAGCAGGTAATGTCATCCTATTTATTGATGAG
    TTGCATACTTTAGTTGGTGCTGGTGGTGCTGAAGGTGCTATCGATGCTTCGAATATTTTG
    AAGCCGGCATTAGCACGTGGTGAATTACAATGTATTGGTGCTACTACATTAGATGAATAT
    CGCAAAAATATTGAAAAAGACGCGGCTTTAGAACGTCGTTTCCAACCTGTACAAGTTGAT
    GAACCTTCAGTAGTAGATACAGTTGCTATTTTAAAAGGATTAAGAGATCGTTACGAAGCA
    CACCATCGTATTAATATTTCAGACGAAGCTATTGAAGCAGCTGTTAAATTAAGTAACAGA
    TACGTTTCAGATCGTTTCTTACCAGATAAAGCAATTGATTTAATTGATGAAGCAAGTTCT
    AAAGTAAGACTTAAGAGTCATACGACACCTAATAATTTAAAAGAAATTGAACAAGAAATT
    GAAAAAGTTAAAAATGAAAAAGATGCCGCAGTACATGCTCAAGAGTTTGAAAATGCTGCT
    AACCTGCGTGATAAACAAACAAAACTTGAAAAGCAATATGAAGAAGCTAAAAATGAATGG
    AAGAATGCACAAAATGGCATGTCAACTTCATTGTCAGAAGAAGATATTGCTGAAGTTATT
    GCAGGATGGACAGGTATCCCATTAACTAAAATCAATGAAACAGAATCTGAAAAACTTCTT
    AGTCTAGAAGATACATTACATGAGAGAGTTATTGGGCAAAAAGATGCTGTTAATTCAATC
    AGTAAAGCGGTTAGACGTGCCCGTGCAGGGTTAAAAGATCCTAAACGACCAATTGGTAGC
    TTTATCTTCCTTGGACCAACTGGTGTTGGTAAAACTGAATTAGCTAGAGCTTTAGCTGAA
    TCAATGTTTGGCGATGATGATGCGATGATCCGTGTAGACATGAGTGAATTTATGGAAAAA
    CACGCAGTGAGCCGATTAGTTGGTGCTCCTCCAGGATATGTTGGTCATGATGATGGTGGA
    CAATTAACTGAAAAAGTTAGACGTAAACCATATTCTGTAATTTTATTTGATGAAATTGAA
    AAAGCTCATCCAGATGTATTTAATATTCTATTACAAGTTTTAGATGATGGACATTTGACA
    GATACAAAAGGACGTACAGTTGATTTCAGAAATACAATTATCATAATGACATCAAACGTT
    GGGGCACAAGAATTACAAGATCAACGATTTGCTGGATTCGGTGGTTCAAGTGATGGACAA
    GATTATGAAACAATTCGAAAAACGATGTTAAAAGAATTAAAAAATTCATTCCGTCCAGAA
    TTTTTAAACCGTGTAGATGATATCATTGTATTCCATAAACTAACAAAAGAAGAATTAAAA
    GAAATTGTAACAATGATGGTTAATAAATTAACAAATCGATTATCTGAACAAAACATAAAT
    ATTATTGTAACTGATAAAGCGAAAGACAAAATCGCAGAAGAAGGATATGATCCAGAATAT
    GGTGCAAGACCATTAATTAGAGCGATACAAAAAACTATCGAAGATAATTTAAGTGAATTA
    ATATTAGATGGTAATCAAATTGAAGGTAAGAAAGTTACAGTAGATCATGATGGTAAAGAG
    TTTAAATATGACATTGCTGAACAAACTTCAGAAACTAAAACACCATCGCAAGCATA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2456

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0570
  • symbol: ClpC
  • description:
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL0833(clpP)ATP-dependent Clp protease proteolytic subunit  [1] (data from MRSA252)
    SACOL2272(modA)molybdenum ABC transporter molybdenum-binding protein ModA  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt: P0C281 UniProt

Protein sequence[edit source | edit]

Experimental data[edit source | edit]

  • quantitative data / protein copy number per cell: 359 [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 60.6 h [3]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  3. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]