From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0692 [new locus tag: SACOL_RS03560 ]
  • pan locus tag?: SAUPAN002511000
  • symbol: SACOL0692
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0692 [new locus tag: SACOL_RS03560 ]
  • symbol: SACOL0692
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 716326..717078
  • length: 753
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAATTATTTATCAAACTTTTTTAATACGACAATTCAACTTAATATATACATTATCGTT
    ATTGTTGCAGCTTGTTATATTGCTATTCATCAATATAGACATAAGCCTGTTTTGAACTAT
    TTAGATGTCATTTTAAACTATATCCCTGTTTTAACACATGAATTTGGTCATGTACTGTTT
    AATAAACTCGCTGGTGGCCGTGCAAAAGATTTAGTCATTGTAACAAGTCCACGAGAGCGA
    CAACAGACATTACAACAAGGATTCGCAATTACACAATCTAGACATCTAGCAGGCCAATGG
    CTTACAACGATTGGTGGTTATTTTATGCCACCTATTATGTTATTGATAGGTTTAGCGTCG
    AGCCATTATCAGATACCTAGTTTCTTTATATTTACCTATTTATTGATATTTATTTATTTT
    TTAATTTTAACATCTAGAAAAGGCTCACCCATTGTTGTTATAACTTTAATTTCTATCATG
    TTGTATTTTATATTAAAAGATGAAAATATAGTAGAAATTCAACTACTTGTCACAATGAGT
    TATCAATATATTTTAGGTGTATTATTAGGCGAAGTTCTACAATCTAGTTGGACGATTGCT
    AAATTGACTTTCCAGCGTCCGAGTCCACAGTGGGATGGTAGTGCACTTAAAGAACTCAGT
    CATGTACCTATCTTCATTTATAGTACAATCTGGATTATCTTCAATCTTTATGCAGTGAAT
    ATTTTACTCAAATATACTCACTTGATAAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    753

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0692 [new locus tag: SACOL_RS03560 ]
  • symbol: SACOL0692
  • description: hypothetical protein
  • length: 250
  • theoretical pI: 9.44382
  • theoretical MW: 28795.9
  • GRAVY: 0.606

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 13.5)
  • TheSEED:  
    FIG01108264: hypothetical protein 
  • PFAM:
    Peptidase_MA (CL0126) Peptidase_M50B; Peptidase M50B-like (PF13398; HMM-score: 152.4)
    no clan definedOtopetrin; Otopetrin (PF03189; HMM-score: 16.5)
    Peptidase_MA (CL0126) Peptidase_M50; Peptidase family M50 (PF02163; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 3
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.109
    • Ymax_pos: 24
    • Cmax: 0.129
    • Cmax_pos: 25
    • Smax: 0.146
    • Smax_pos: 14
    • Smean: 0.096
    • D: 0.104
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNYLSNFFNTTIQLNIYIIVIVAACYIAIHQYRHKPVLNYLDVILNYIPVLTHEFGHVLFNKLAGGRAKDLVIVTSPRERQQTLQQGFAITQSRHLAGQWLTTIGGYFMPPIMLLIGLASSHYQIPSFFIFTYLLIFIYFLILTSRKGSPIVVITLISIMLYFILKDENIVEIQLLVTMSYQYILGVLLGEVLQSSWTIAKLTFQRPSPQWDGSALKELSHVPIFIYSTIWIIFNLYAVNILLKYTHLIN

Experimental data[edit source | edit]

  • experimental localization: Integral membrane [1]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL0692 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]