From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0886 [new locus tag: SACOL_RS04550 ]
  • pan locus tag?: SAUPAN002842000
  • symbol: sek
  • pan gene symbol?: sek
  • synonym:
  • product: enterotoxin

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0886 [new locus tag: SACOL_RS04550 ]
  • symbol: sek
  • product: enterotoxin
  • replicon: chromosome
  • strand: -
  • coordinates: 904800..905528
  • length: 729
  • essential: unknown

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAAAATTAATAAGCATCTTATTAATAAATATAATAATTTTAGGTGTCTCTAATAGT
    GCCAGCGCTCAAGGTGATATAGGAATTGATAATCTCAGGAATTTTTATACAAAAAAAGAC
    TTCGTAGATTTAAAAGATGTAAAAGACAATGATACTCCTATAGCTAATCAACTACAATTT
    TCAAATGAATCTTATGATTTAATTTCAGAATCAAAAGATTTTAATAAATTTAGTAATTTC
    AAGGGAAAAAAACTTGATGTTTTTGGTATTAGTTATAATGGCCAGTGTAACACTAAATAC
    ATATATGGCGGAGTCACAGCTACTAACGAATATCTAGATAAATCTAGAAATATACCTATA
    AATATATGGATTAATGGAAATCACAAAACTATTTCTACCAATAAAGTTTCGACAAATAAA
    AAATTTGTTACCGCTCAAGAGATTGATGTCAAATTAAGAAAGTACCTTCAAGAAGAATAC
    AACATTTATGGACATAACGGCACTAAAAAAGGAGAAGAATATGGTCATAAATCAAAATTT
    TATTCTGGATTTAATATTGGTAAAGTAACGTTCCATTTAAATAATAATGACACTTTTTCA
    TATGATTTATTCTACACAGGAGATGATGGGTTACCAAAAAGTTTTTTAAAAATTTACGAA
    GACAATAAAACTGTAGAGTCTGAGAAATTCCATTTGGATGTCGATATTTCTTATAAAGAA
    ACGATATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    729

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0886 [new locus tag: SACOL_RS04550 ]
  • symbol: Sek
  • description: enterotoxin
  • length: 242
  • theoretical pI: 8.31662
  • theoretical MW: 27726.9
  • GRAVY: -0.609917

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismCentral intermediary metabolismPolyamine biosynthesisagmatine deiminase (TIGR03380; EC 3.5.3.12; HMM-score: 12)
  • TheSEED:  
    Phages, Prophages, Transposable elements, PlasmidsPathogenicity islandsStaphylococcal pathogenicity islands SaPI Superantigen enterotoxin SEK 
  • PFAM:
    Ant-toxin_C (CL0386) Stap_Strp_tox_C; Staphylococcal/Streptococcal toxin, beta-grasp domain (PF02876; HMM-score: 119.6)
    OB_enterotoxin (CL0658) Stap_Strp_toxin; Staphylococcal/Streptococcal toxin, OB-fold domain (PF01123; HMM-score: 23.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 10
    • Internal Helix: 1
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: NSASAQGD
  • SignalP: Signal peptide length 24 aa
    • Ymax: 0.676
    • Ymax_pos: 24
    • Cmax: 0.653
    • Cmax_pos: 24
    • Smax: 0.798
    • Smax_pos: 19
    • Smean: 0.681
    • D: 0.678
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKKLISILLINIIILGVSNSASAQGDIGIDNLRNFYTKKDFVDLKDVKDNDTPIANQLQFSNESYDLISESKDFNKFSNFKGKKLDVFGISYNGQCNTKYIYGGVTATNEYLDKSRNIPINIWINGNHKTISTNKVSTNKKFVTAQEIDVKLRKYLQEEYNIYGHNGTKKGEEYGHKSKFYSGFNIGKVTFHLNNNDTFSYDLFYTGDDGLPKSFLKIYEDNKTVESEKFHLDVDISYKETI

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]