From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1062 [new locus tag: SACOL_RS05415 ]
  • pan locus tag?: SAUPAN003260000
  • symbol: atl
  • pan gene symbol?: atl
  • synonym:
  • product: bifunctional autolysin

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1062 [new locus tag: SACOL_RS05415 ]
  • symbol: atl
  • product: bifunctional autolysin
  • replicon: chromosome
  • strand: -
  • coordinates: 1067693..1071463
  • length: 3771
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    ATGGCGAAAAAATTCAATTACAAACTACCATCAATGGTTGCATTAACGCTTGTAGGTTCA
    GCAGTCACTGCACATCAAGTTCAAGCAGCTGAGACGACACAAGATCAAACTACTAATAAA
    AACGTTTTAGATAGTAATAAAGTTAAAGCAACTACTGAACAAGCAAAAGCTGAGGTAAAA
    AATCCAACGCAAAACATTTCTGGCACTCAAGTATATCAAGACCCTGCTATTGTCCAACCA
    AAAACAGCAAATAACAAAACAGGCAATGCTCAAGTAAGTCAAAAAGTTGATACTGCACAA
    GTAAATGGTGACACTCGTGCTAATCAATCAGCGACTACAAATAATACGCAGCCTGTTGCA
    AAGTCAACAAGCACTACAGCACCTAAAACTAACACTAATGTTACAAATGCTGGTTATAGT
    TTAGTTGATGATGAAGATGATAATTCAGAAAATCAAATTAATCCAGAATTAATTAAATCA
    GCTGCTAAACCTGCAGCTCTTGAAACGCAATATAAAACCGCAGCACCTAAAGCTGCAACT
    ACATCAGCACCTAAAGCTAAAACTGAAGCGACACCTAAAGTAACTACTTTTAGCGCTTCA
    GCACAACCAAGATCAGTTGCTGCAACACCAAAAACGAGTTTGCCAAAATATAAACCACAA
    GTAAACTCTTCAATTAACGATTACATTCGTAAAAATAACTTAAAAGCACCTAAAATTGAA
    GAAGATTATACATCTTACTTCCCTAAATACGCATACCGTAACGGCGTAGGTCGTCCTGAA
    GGTATCGTAGTTCATGATACAGCTAATGATCGTTCGACGATAAATGGTGAAATTAGTTAT
    ATGAAAAATAACTATCAAAACGCATTCGTACATGCATTTGTTGATGGGGATCGTATAATC
    GAAACAGCACCAACGGATTACTTATCTTGGGGTGTCGGTGCAGTCGGTAACCCTAGATTC
    ATCAATGTTGAAATCGTACACACACACGACTATGCTTCATTTGCACGTTCAATGAATAAC
    TATGCTGACTATGCAGCTACACAATTACAATATTATGGTTTAAAACCAGACAGTGCTGAG
    TATGATGGAAATGGTACAGTATGGACTCACTACGCTGTAAGTAAATATTTAGGTGGTACT
    GACCATGCCGATCCACATGGATATTTAAGAAGTCATAATTATAGTTATGATCAATTATAT
    GACTTAATTAATGAAAAATATTTAATAAAAATGGGTAAAGTGGCGCCATGGGGTACGCAA
    TCTACAACTACCCCTACTACACCATCAAAACCAACAACACCGTCGAAACCATCAACTGGT
    AAATTAACAGTTGCTGCAAACAATGGTGTCGCACAAATCAAACCAACAAATAGTGGTTTA
    TATACTACTGTATACGACAAAACTGGTAAAGCAACTAATGAAGTTCAAAAAACATTTGCT
    GTATCTAAAACAGCTACATTAGGTAATCAAAAATTCTATCTTGTTCAAGATTACAATTCT
    GGTAATAAATTTGGTTGGGTTAAAGAAGGCGATGTGGTTTACAACACAGCTAAATCACCT
    GTAAATGTAAATCAATCATATTCAATCAAACCTGGTACGAAACTTTATACAGTACCTTGG
    GGTACATCTAAACAAGTTGCTGGTAGTGTGTCTGGCTCTGGAAACCAAACATTTAAGGCT
    TCAAAGCAACAACAAATTGATAAATCAATTTATTTATATGGCTCTGTGAATGGTAAATCT
    GGTTGGGTAAGTAAAGCATATTTAGTTGATACTGCTAAACCTACGCCTACACCAACACCT
    AAGCCATCAACACCTACAACAAATAATAAATTAACAGTTTCATCATTAAACGGTGTTGCT
    CAAATTAATGCTAAAAACAATGGCTTATTCACTACAGTTTATGACAAAACTGGTAAGCCA
    ACGAAAGAAGTTCAAAAAACATTTGCTGTAACAAAAGAAGCAAGTTTAGGTGGAAACAAA
    TTCTACTTAGTTAAAGATTACAATAGTCCAACTTTAATTGGTTGGGTTAAACAAGGTGAC
    GTTATTTATAACAATGCAAAATCACCTGTAAATGTAATGCAAACATATACAGTAAAACCA
    GGCACTAAATTATATTCAGTACCTTGGGGCACTTATAAACAAGAAGCTGGTGCAGTTTCT
    GGTACAGGTAACCAAACTTTTAAAGCGACTAAGCAACAACAAATTGATAAATCTATCTAT
    TTATTTGGAACTGTAAATGGTAAATCTGGTTGGGTAAGTAAAGCATATTTAGCTGTACCT
    GCTGCACCTAAAAAAGCAGTAGCACAACCAAAAACAGCTGTAAAAGCTTATACTGTTACT
    AAACCACAAACGACTCAAACAGTTAGCAAGATTGCTCAAGTTAAACCAAACAACACTGGT
    ATTCGTGCTTCTGTTTATGAAAAAACAGCGAAAAACGGTGCGAAATATGCAGACCGTACG
    TTCTATGTAACAAAAGAGCGTGCTCATGGTAATGAAACGTATGTATTATTAAACAATACA
    AGCCATAACATCCCATTAGGTTGGTTCAATGTAAAAGACTTAAATGTTCAAAACTTAGGC
    AAAGAAGTTAAAACGACTCAAAAATATACTGTTAATAAATCAAATAACGGCTTATCAATG
    GTTCCTTGGGGTACTAAAAACCAAGTCATTTTAACAGGCAATAACATTGCTCAAGGTACA
    TTTAATGCAACGAAACAAGTATCTGTAGGCAAAGATGTTTATTTATACGGTACTATTAAT
    AACCGCACTGGTTGGGTAAATGCAAAAGATTTAACTGCACCAACTGCTGTGAAACCAACT
    ACATCAGCTGCCAAAGATTATAACTACACTTATGTAATTAAAAATGGTAATGGTTATTAC
    TATGTAACACCAAATTCTGATACAGCTAAATACTCATTAAAAGCATTTAATGAACAACCA
    TTCGCAGTTGTTAAAGAACAAGTCATTAATGGACAAACTTGGTACTATGGTAAATTATCT
    AACGGTAAATTAGCATGGATTAAATCAACTGATTTAGCTAAAGAATTAATTAAGTATAAT
    CAAACAGGTATGGCATTAAACCAAGTTGCTCAAATACAAGCTGGTTTACAATATAAACCA
    CAAGTACAACGTGTACCAGGTAAGTGGACAGGTGCTAACTTTAATGATGTTAAGCATGCA
    ATGGATACGAAGCGTTTAGCTCAAGATCCAGCATTAAAATATCAATTCTTACGCTTAGAC
    CAACCACAAAATATTTCTATTGATAAAATTAATCAATTCTTAAAAGGTAAAGGTGTATTA
    GAAAACCAAGGTGCTGCATTTAACAAAGCTGCTCAAATGTATGGCATTAATGAAGTTTAT
    CTTATCTCACATGCCCTATTAGAAACAGGTAACGGTACTTCTCAATTAGCGAAAGGTGCA
    GATGTAGTGAACAACAAAGTTGTAACTAACTCAAACACGAAATACCATAACGTATTTGGT
    ATTGCTGCATATGATAACGATCCTTTACGTGAAGGTATTAAATATGCTAAACAAGCTGGT
    TGGGACACAGTATCAAAAGCAATCGTTGGTGGTGCTAAATTCATCGGCAACTCATATGTA
    AAAGCTGGTCAAAATACACTTTACAAAATGAGATGGAATCCTGCACATCCAGGAACACAC
    CAATATGCTACAGATGTAGATTGGGCTAACATCAATGCTAAAATCATCAAAGGCTACTAT
    GATAAAATTGGCGAAGTCGGCAAATACTTCGACATCCCACAATATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3771

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1062 [new locus tag: SACOL_RS05415 ]
  • symbol: Atl
  • description: bifunctional autolysin
  • length: 1256
  • theoretical pI: 10.1019
  • theoretical MW: 137334
  • GRAVY: -0.616162

Function[edit source | edit]

  • reaction:
    EC 3.5.1.28?  ExPASy
    N-acetylmuramoyl-L-alanine amidaseHydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides
    EC 3.2.1.96?  ExPASy
    Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidaseEndohydrolysis of the N,N'-diacetylchitobiosyl unit in high-mannose glycopeptides and glycoproteins containing the -(Man(GlcNAc)2)Asn-structure. One N-acetyl-D-glucosamine residue remains attached to the protein; the rest of the oligosaccharide is released intact
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsV-type ATPase, D subunit (TIGR00309; EC 3.6.3.14; HMM-score: 9.9)
  • TheSEED:  
    Adhesins in Staphylococcus Bifunctional autolysin Atl / N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)/ endo-beta-N-acetylglucosaminidase (EC 3.2.1.96) 
    Biofilm formation in Staphylococcus Bifunctional autolysin Atl / N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)/ endo-beta-N-acetylglucosaminidase (EC 3.2.1.96) 
    Cell envelope-associated LytR-CpsA-Psr transcriptional attenuators Bifunctional autolysin Atl / N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)/ endo-beta-N-acetylglucosaminidase (EC 3.2.1.96) 
  • PFAM:
    Lysozyme (CL0037) Glucosaminidase; Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase (PF01832; HMM-score: 54.1)
    SH3 (CL0010) SH3_8; SH3-like domain (PF13457; HMM-score: 47.2)
    no clan definedDGOK; 2-keto-3-deoxy-galactonokinase (PF05035; HMM-score: 25.1)
    DUF780; Caenorhabditis elegans protein of unknown function (DUF780) (PF05611; HMM-score: 13.2)
    SH3 (CL0010) SH3_3; Bacterial SH3 domain (PF08239; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.02
    • Extracellular Score: 9.98
    • Internal Helices: 0
  • LocateP: Secretory(released) (with CS)
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: -0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: HQVQAAET
  • SignalP: Signal peptide length 30 aa
    • Ymax: 0.841
    • Ymax_pos: 30
    • Cmax: 0.752
    • Cmax_pos: 30
    • Smax: 0.957
    • Smax_pos: 13
    • Smean: 0.934
    • D: 0.877
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAKKFNYKLPSMVALTLVGSAVTAHQVQAAETTQDQTTNKNVLDSNKVKATTEQAKAEVKNPTQNISGTQVYQDPAIVQPKTANNKTGNAQVSQKVDTAQVNGDTRANQSATTNNTQPVAKSTSTTAPKTNTNVTNAGYSLVDDEDDNSENQINPELIKSAAKPAALETQYKTAAPKAATTSAPKAKTEATPKVTTFSASAQPRSVAATPKTSLPKYKPQVNSSINDYIRKNNLKAPKIEEDYTSYFPKYAYRNGVGRPEGIVVHDTANDRSTINGEISYMKNNYQNAFVHAFVDGDRIIETAPTDYLSWGVGAVGNPRFINVEIVHTHDYASFARSMNNYADYAATQLQYYGLKPDSAEYDGNGTVWTHYAVSKYLGGTDHADPHGYLRSHNYSYDQLYDLINEKYLIKMGKVAPWGTQSTTTPTTPSKPTTPSKPSTGKLTVAANNGVAQIKPTNSGLYTTVYDKTGKATNEVQKTFAVSKTATLGNQKFYLVQDYNSGNKFGWVKEGDVVYNTAKSPVNVNQSYSIKPGTKLYTVPWGTSKQVAGSVSGSGNQTFKASKQQQIDKSIYLYGSVNGKSGWVSKAYLVDTAKPTPTPTPKPSTPTTNNKLTVSSLNGVAQINAKNNGLFTTVYDKTGKPTKEVQKTFAVTKEASLGGNKFYLVKDYNSPTLIGWVKQGDVIYNNAKSPVNVMQTYTVKPGTKLYSVPWGTYKQEAGAVSGTGNQTFKATKQQQIDKSIYLFGTVNGKSGWVSKAYLAVPAAPKKAVAQPKTAVKAYTVTKPQTTQTVSKIAQVKPNNTGIRASVYEKTAKNGAKYADRTFYVTKERAHGNETYVLLNNTSHNIPLGWFNVKDLNVQNLGKEVKTTQKYTVNKSNNGLSMVPWGTKNQVILTGNNIAQGTFNATKQVSVGKDVYLYGTINNRTGWVNAKDLTAPTAVKPTTSAAKDYNYTYVIKNGNGYYYVTPNSDTAKYSLKAFNEQPFAVVKEQVINGQTWYYGKLSNGKLAWIKSTDLAKELIKYNQTGMALNQVAQIQAGLQYKPQVQRVPGKWTGANFNDVKHAMDTKRLAQDPALKYQFLRLDQPQNISIDKINQFLKGKGVLENQGAAFNKAAQMYGINEVYLISHALLETGNGTSQLAKGADVVNNKVVTNSNTKYHNVFGIAAYDNDPLREGIKYAKQAGWDTVSKAIVGGAKFIGNSYVKAGQNTLYKMRWNPAHPGTHQYATDVDWANINAKIIKGYYDKIGEVGKYFDIPQYK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [6] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 9.25 h [7]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Annette Dreisbach, Kristina Hempel, Girbe Buist, Michael Hecker, Dörte Becher, Jan Maarten van Dijl
    Profiling the surfacome of Staphylococcus aureus.
    Proteomics: 2010, 10(17);3082-96
    [PubMed:20662103] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int. J. Med. Microbiol.: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

T Oshida, M Sugai, H Komatsuzawa, Y M Hong, H Suginaka, A Tomasz
A Staphylococcus aureus autolysin that has an N-acetylmuramoyl-L-alanine amidase domain and an endo-beta-N-acetylglucosaminidase domain: cloning, sequence analysis, and characterization.
Proc. Natl. Acad. Sci. U.S.A.: 1995, 92(1);285-9
[PubMed:7816834] [WorldCat.org] (P p)