From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1159 [new locus tag: SACOL_RS05920 ]
  • pan locus tag?: SAUPAN003388000
  • symbol: sdhA
  • pan gene symbol?: sdhA
  • synonym:
  • product: succinate dehydrogenase flavoprotein subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1159 [new locus tag: SACOL_RS05920 ]
  • symbol: sdhA
  • product: succinate dehydrogenase flavoprotein subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1168997..1170763
  • length: 1767
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    ATGGCAGAGAAACATCTTATTGTTGTCGGAGGTGGCCTAGCGGGCTTAATGTCAACAATT
    AAAGCGGCAGAAAAAGGTGCACATGTAGATTTGTTCTCAGTTGTACCAGTAAAGCGTTCG
    CACTCTGTTTGTGCCCAAGGTGGCATTAATGGTGCGGTCAATACTAAAGGGGAAGGCGAT
    TCTCCTTGGATTCACTTTGATGATACAGTGTATGGTGGCGATTTCCTTGCAAACCAACCA
    CCTGTTAAAGCGATGACAGAGGCAGCACCTAAAATTATTCATTTATTAGACCGTATGGGC
    GTAATGTTCAATAGAACAAATGAAGGTCTATTAGATTTTAGACGTTTCGGTGGTACATTA
    CATCACAGAACAGCATATGCAGGGGCAACAACTGGACAACAATTATTATATGCATTGGAT
    GAACAAGTTCGTGCATATGAAGTAGATGGATTAGTTACGAAGTATGAAGGATGGGAATTC
    CTTGGCATAGTTAAAGGTGACGATGATAGTGCAAGAGGTATCGTTGCACAAAATATGACA
    ACTGCTGAGATTGAAACATTTGGTTCAGATGCAGTTATTATGGCAACGGGTGGCCCTGGT
    ATTATTTTCGGTAAAACAACAAACTCAATGATTAATACAGGATCAGCGGCTTCCATTGTT
    TACCAACAAGGCGCTATTTATGCTAATGGTGAGTTCATTCAAATTCATCCTACTGCAATC
    CCTGGTGATGATAAACTGCGACTAATGAGTGAATCAGCACGTGGTGAAGGTGGACGAATT
    TGGACATATAAAGATGGTAAGCCTTGGTACTTCTTAGAAGAGAAATATCCTGATTATGGT
    AACTTAGTACCTCGTGATATCGCAACGCGTGAAATTTTCGATGTATGTATTAACCAAAAA
    TTAGGTATAAATGGCGAAAACATGGTATATCTTGATTTGTCACATAAAGATCCACATGAG
    TTAGATGTAAAACTAGGTGGTATCATTGAGATTTATGAAAAATTCACTGGTGATGACCCA
    CGCAAAGTACCAATGAAGATTTTCCCAGCTGTTCACTATTCAATGGGTGGTCTATATGTA
    GATTATGATCAAATGACAAATATTAAAGGGTTATTTGCAGCTGGAGAATGTGACTTCTCT
    CAACATGGTGGTAACCGCTTAGGTGCCAATTCATTGTTATCAGCGATTTATGGTGGTACA
    GTAGCAGGTCCAAACGCGATTGATTATATTTCAAATATTGATCGATCATATACTGATATG
    GACGAAAGTATTTTTGAAAAGCGTAAAGCTGAAGAGCAAGAACGTTTTGATAAATTATTA
    GCTATGCGCGGTACAGAAAATGCATATAAATTACACCGTGAACTTGGTGAAATTATGACA
    GCAAATGTAACTGTTGTTCGTGAAAATGAAAAACTGTTAGAAACAGATAAAAAGATTGTT
    GAATTGATGAAACGTTATGAAGATATTGATATGGAAGATACTCAAACTTGGAGTAACCAA
    GCGGTATTCTTTACCCGTCAACTATGGAACATGTTAGTACTTGCACGTGTTATTACGATT
    GGTGCATATAACCGTAACGAATCACGCGGTGCCCATTATAAACCAGAATTCCCAGAGCGT
    AATGATGAAGAGTGGTTAAAAACGACAATGGCCTCATTCCAAGGCGCATTTGAAAAACCG
    CAGTTTACTTATGATGACGTCGATGTGAGTTTAATACCACCTCGTAAACGTGATTACACA
    AGTAAGTCTAAAGGGGGTAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1767

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1159 [new locus tag: SACOL_RS05920 ]
  • symbol: SdhA
  • description: succinate dehydrogenase flavoprotein subunit
  • length: 588
  • theoretical pI: 5.3235
  • theoretical MW: 65502.6
  • GRAVY: -0.398129

Function[edit source | edit]

  • reaction:
    EC 1.3.99.1?  ExPASy
    Deleted entry
    EC 1.3.5.1?  ExPASy
    Succinate dehydrogenase (quinone)Succinate + a quinone = fumarate + a quinol
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 970.9)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    MetabolismEnergy metabolismAnaerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    MetabolismEnergy metabolismAerobicsuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01812; HMM-score: 475.7)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase, flavoprotein subunit (TIGR01816; HMM-score: 364.7)
    fumarate reductase (quinol), flavoprotein subunit (TIGR01176; EC 1.3.5.4; HMM-score: 333.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 274.9)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 119)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 19.5)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 17.2)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylylsulfate reductase, alpha subunit (TIGR02061; EC 1.8.99.2; HMM-score: 15.5)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 14.3)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 14.2)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 14.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin 3B synthase CobZ (TIGR02485; HMM-score: 14.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 13.7)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 13.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 12.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 12.7)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 12.5)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 11.7)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 11.3)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 11.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 10.9)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 10.2)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 9.6)
  • TheSEED:  
    Serine-glyoxylate cycle Succinate dehydrogenase flavoprotein subunit (EC 1.3.5.1) 
    Succinate dehydrogenase Succinate dehydrogenase flavoprotein subunit (EC 1.3.5.1) 
    TCA Cycle Succinate dehydrogenase flavoprotein subunit (EC 1.3.5.1) 
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_2; FAD binding domain (PF00890; HMM-score: 283.8)
    no clan definedSucc_DH_flav_C; Fumarate reductase flavoprotein C-term (PF02910; HMM-score: 141.3)
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 24)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 19.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 18.5)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 14.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 14.3)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 14)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 13)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.5
    • Signal Peptide Possibility: 0
    • N-terminally Anchored Score: 9
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.408
    • Ymax_pos: 23
    • Cmax: 0.465
    • Cmax_pos: 23
    • Smax: 0.709
    • Smax_pos: 22
    • Smean: 0.312
    • D: 0.37
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAEKHLIVVGGGLAGLMSTIKAAEKGAHVDLFSVVPVKRSHSVCAQGGINGAVNTKGEGDSPWIHFDDTVYGGDFLANQPPVKAMTEAAPKIIHLLDRMGVMFNRTNEGLLDFRRFGGTLHHRTAYAGATTGQQLLYALDEQVRAYEVDGLVTKYEGWEFLGIVKGDDDSARGIVAQNMTTAEIETFGSDAVIMATGGPGIIFGKTTNSMINTGSAASIVYQQGAIYANGEFIQIHPTAIPGDDKLRLMSESARGEGGRIWTYKDGKPWYFLEEKYPDYGNLVPRDIATREIFDVCINQKLGINGENMVYLDLSHKDPHELDVKLGGIIEIYEKFTGDDPRKVPMKIFPAVHYSMGGLYVDYDQMTNIKGLFAAGECDFSQHGGNRLGANSLLSAIYGGTVAGPNAIDYISNIDRSYTDMDESIFEKRKAEEQERFDKLLAMRGTENAYKLHRELGEIMTANVTVVRENEKLLETDKKIVELMKRYEDIDMEDTQTWSNQAVFFTRQLWNMLVLARVITIGAYNRNESRGAHYKPEFPERNDEEWLKTTMASFQGAFEKPQFTYDDVDVSLIPPRKRDYTSKSKGGKK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Signal peptide containing [1] [2] [3] [4]
    quantitative data / protein copy number per cell: 228 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]