From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1435 [new locus tag: SACOL_RS07310 ]
  • pan locus tag?: SAUPAN003813000
  • symbol: lysA
  • pan gene symbol?: lysA
  • synonym:
  • product: diaminopimelate decarboxylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1435 [new locus tag: SACOL_RS07310 ]
  • symbol: lysA
  • product: diaminopimelate decarboxylase
  • replicon: chromosome
  • strand: +
  • coordinates: 1447587..1448852
  • length: 1266
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTGTTAAATATAATCAAAATGGCGAATTAACAATGGATGGTATTAGTTTAAAAACG
    ATTGCACAAAGCTTTGGTACACCTACCATTGTTTATGATGAACTACAAATTAGAGAACAG
    ATGCGCCGTTACCATCGCGCATTTAAAGATAGTGGATTAAAATACAATATTTCATACGCC
    TCAAAGGCATTTACTTGCATTCAAATGGTCAAACTTGTAGCTGAGGAAGATTTACAGTTA
    GATGTTGTTTCTGAAGGTGAATTATATACAGCTTTAGAAGCAGGTTTTGAACCGAGTCGC
    ATCCATTTCCATGGTAACAATAAAACGAAACATGAAATTAGGTATGCTTTAGAAAATAAT
    ATCGGTTATTTTGTTATAGATTCATTAGAAGAAATTGAATTAATAGACCGCTATGCTAAT
    GATACGGTTCAAGTTGTATTACGAGTTAATCCAGGTGTTGAAGCACATACACACGAATTT
    ATTCAAACTGGGCAAGAAGATAGTAAGTTTGGATTATCAATTCAATATGGCTTAGCTAAA
    AAAGCAATTGACAAAGTCCAACAATCTAAACACTTAAAATTAAAAGGTGTACATTGTCAT
    ATTGGTTCACAGATTGAAGGTACAGAAGCATTTATTGAAACTGCTAAAATTGTTTTACGT
    TGGCTTAAAGAGCAAGGCATTCAAGTTGAATTATTAAACCTTGGTGGTGGCTTTGGTATT
    AAATATGTTGAAGGTGACGAAAGTTTCCCTATCGAAAGTGGTATTAAAGATATTACAGAC
    GCAATAAAATCCGAAATTAAAGTTCTAGGTATAGATGCACCAGAAATAGGTATTGAACCG
    GGACGATCAATTGTAGGTGAAGCTGGCGTTACTTTATATGAAGTTGGAACCATTAAAGAA
    ATTCCAGAGATTAATAAATATGTTTCAATCGATGGCGGTATGAGTGATCATATCAGAACT
    GCACTTTATGACGCAAAGTATCAAGCATTGCTTGTTAATAGAAATGAAGAAGCAGATGAC
    AGTGTAACTATAGCTGGAAAATTATGTGAGTCTGGTGATATCATTATTAAAGACGCTAAA
    TTACCTTCATCAGTCAAACGTGGAGACTATCTTGCTATATTATCAACTGGTGCATATCAT
    TACTCTATGGCATCCAATTACAATCAAATGCAAAAGCCTTCTGTGTTTTTCTTAAAAGAT
    GGCAAAGCACGTGAAGTTATAAAGCGACAATCGTTAAGACAACTCATTATTAATGATACA
    AAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1266

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1435 [new locus tag: SACOL_RS07310 ]
  • symbol: LysA
  • description: diaminopimelate decarboxylase
  • length: 421
  • theoretical pI: 5.65794
  • theoretical MW: 47034.2
  • GRAVY: -0.284086

Function[edit source | edit]

  • reaction:
    EC 4.1.1.20?  ExPASy
    Diaminopimelate decarboxylaseMeso-2,6-diaminoheptanedioate = L-lysine + CO2
  • TIGRFAM:
    MetabolismAmino acid biosynthesisAspartate familydiaminopimelate decarboxylase (TIGR01048; EC 4.1.1.20; HMM-score: 461.8)
    pyridoxal-dependent decarboxylase, exosortase A system-associated (TIGR03099; HMM-score: 183.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesisarginine decarboxylase (TIGR01273; EC 4.1.1.19; HMM-score: 57.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesiscarboxynorspermidine decarboxylase (TIGR01047; HMM-score: 38)
    Unknown functionEnzymes of unknown specificitypyridoxal phosphate enzyme, YggS family (TIGR00044; HMM-score: 12.7)
  • TheSEED:  
    Amino Acids and DerivativesLysine, threonine, methionine, and cysteineLysine Biosynthesis DAP Pathway Diaminopimelate decarboxylase (EC 4.1.1.20) 
  • PFAM:
    TIM_barrel (CL0036) Orn_Arg_deC_N; Pyridoxal-dependent decarboxylase, pyridoxal binding domain (PF02784; HMM-score: 226)
    no clan definedOrn_DAP_Arg_deC; Pyridoxal-dependent decarboxylase, C-terminal sheet domain (PF00278; HMM-score: 67.3)
    TIM_barrel (CL0036) Ala_racemase_N; Alanine racemase, N-terminal domain (PF01168; HMM-score: 21)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SACOL0988(fabF)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SACOL1960(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [1] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL1746(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2240(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SACOL0435GTP-dependent nucleic acid-binding protein EngD  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 25
    • Cmax: 0.135
    • Cmax_pos: 25
    • Smax: 0.193
    • Smax_pos: 5
    • Smean: 0.144
    • D: 0.14
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTVKYNQNGELTMDGISLKTIAQSFGTPTIVYDELQIREQMRRYHRAFKDSGLKYNISYASKAFTCIQMVKLVAEEDLQLDVVSEGELYTALEAGFEPSRIHFHGNNKTKHEIRYALENNIGYFVIDSLEEIELIDRYANDTVQVVLRVNPGVEAHTHEFIQTGQEDSKFGLSIQYGLAKKAIDKVQQSKHLKLKGVHCHIGSQIEGTEAFIETAKIVLRWLKEQGIQVELLNLGGGFGIKYVEGDESFPIESGIKDITDAIKSEIKVLGIDAPEIGIEPGRSIVGEAGVTLYEVGTIKEIPEINKYVSIDGGMSDHIRTALYDAKYQALLVNRNEEADDSVTIAGKLCESGDIIIKDAKLPSSVKRGDYLAILSTGAYHYSMASNYNQMQKPSVFFLKDGKAREVIKRQSLRQLIINDTK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 1728 [6]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CodY
    CodY (TF) important in Amino acid metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 47.51 h [7]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  4. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  5. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  6. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol. Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

H De Lencastre, S W Wu, M G Pinho, A M Ludovice, S Filipe, S Gardete, R Sobral, S Gill, M Chung, A Tomasz
Antibiotic resistance as a stress response: complete sequencing of a large number of chromosomal loci in Staphylococcus aureus strain COL that impact on the expression of resistance to methicillin.
Microb. Drug Resist.: 1999, 5(3);163-75
[PubMed:10566865] [WorldCat.org] (P p)